Anemone biflora

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemone

At a glance

Occurrence records73

Data sources7

Biological traits25

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Anemone biflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF73 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Anemone biflora là một loài thực vật có hoa trong họ Mao lương. Loài này được DC. mô tả khoa học đầu tiên năm 1817.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length2.5 mm

Fruit length max2.5 mm

Fruit length min2.5 mm

Leaf length10 mm

Leaf length max14 mm

Leaf length min6 mm

Leaf width15.5 mm

Leaf width max22 mm

Leaf width min9 mm

Plant height0.055 m

Plant height max0.25 m

Plant height min0.02 m

Life cycle & reproduction4

Flowering endApr

Flowering startApr

Life formtuberous geophyte

Life spanperennial

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max3 100 m

Elevation mean2 250 m

Elevation min800 m

Growth formherb

Habitat GIFTmeadows, mountains, rivers, saline places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemone biflora has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSPP476516.1 ↗451 bp

ACGT

AATCCGGCGCAACTGGCGTCAAGGAAAACTCAACGGAAGCAGGGCGTCGGCTCGTCCGGCGCTTCGTATCCGAATACTCAAACGACTCTC …

Anemone biflora var. gortschakowii voucher Orazova A. & Fissun V. 19762204 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anemone biflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1

CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.

CCDB · book-indian_vol1 — Durani, P.K. & Kaul, V. 1969

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type73 records

Wild obs. + sensor44

Museum / vouchered9

Cultivated / captive2

Other18

Origin

Native2

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 24≤1 km 3≤10 km 2

29 georeferenced · 15 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	3
BRNUlocation not on record	1
MeiseBGlocation not on record	1
South Kensington, GB	1
McWane Science Centerlocation not on record	1
Edinburgh, GB	1

6 institutions · 8 of 9 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)