Anemonastrum obtusilobum

(D.Don) Mosyakin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemonastrum

At a glance

Occurrence records23

Data sources5

Biological traits24

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Anemonastrum obtusilobum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility23 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources24 traits

Chemical compositionLOTUS · NPASS13 compounds

Occurrence & distributionGBIF23 records

DNA & barcodingNCBIsequences

01Narrative

Anemonastrum obtusilobum (syn. Anemone obtusiloba), the round-leaved anemone, is a species of flowering plant in the family Ranunculaceae, native to mountainous regions of Pakistan, Myanmar, Nepal and western China (Tibet), and also cultivated as an ornamental. It is a low-growing, clump forming perennial plant to , with rounded hairy leaves and variable flowers of white, blue or occasionally yellow. The flowers consist of 4-7 rounded petals surrounding a prominent yellow central boss, and appear in spring to early summer. The plant is reasonably hardy, but requires a sheltered spot in full sun or partial shade. It is suitable as an underplanting for deciduous trees or shrubs. Anemone obtusiloba (2562162846).jpg Anemone obtusiloba 'Pradesh' (8999892687).jpg|'Pradesh'

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology9

Leaf length21 mm

Leaf length max30 mm

Leaf length min12 mm

Leaf width36 mm

Leaf width max55 mm

Leaf width min17 mm

Plant height0.2 m

Plant height max0.3 m

Plant height min0.04 m

Life cycle & reproduction5

Flowering endJul

Flowering startJul

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max4 000 m

Elevation mean3 450 m

Elevation min2 100 m

Growth formherb

Habitat GIFTmountains, stony places, tundra

Woodinessnon-woody

03Chemical composition13 compounds

Compounds documented for Anemonastrum obtusilobum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Tripeptides4

Carotenoids (C40, β-Ψ)1

Miscellaneous polyketides1

Oleanane triterpenoids1

Flavonols1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-2-[[(2S)-2-(2-methylbut-3-en-2-ylamino)-3-phenylpropanoyl]amino]-3-phenyl-N-[(1S)-2-phenyl-1-(1,3-thiazol-2-yl)ethyl]propanamide	present	NPASS
(2S)-2-[[(2S)-2-(2-methylbut-3-en-2-ylamino)-3-phenylpropanoyl]amino]-N-[(1S)-2-methyl-1-(1,3-thiazol-2-yl)propyl]-3-phenylpropanamide	present	NPASS
(2S)-2-[[(2S)-2-[bis(3-methylbut-2-enyl)amino]-3-phenylpropanoyl]amino]-3-methyl-N-[(1S)-2-methyl-1-(1,3-thiazol-2-yl)propyl]butanamide	present	NPASS
(2S)-3-methyl-2-[[(2S)-2-(3-methylbut-2-enylamino)-3-phenylpropanoyl]amino]-N-[(1S)-2-methyl-1-(1,3-thiazol-2-yl)propyl]butanamide	present	NPASS
(2S)-3-methyl-N-[(1S)-2-methyl-1-(1,3-thiazol-2-yl)propyl]-2-[[(E)-3-phenylprop-2-enoyl]amino]butanamide	present	NPASS
(4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5S,6R)-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-5-[(2S,3R,4R,5R,6S)-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-methyloxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(7E,7aR)-5-hydroxy-7-prop-2-enylidene-2,7a-dihydrocyclopenta[b]pyran-6-one	present	NPASS
(7Z,7aR)-5-hydroxy-7-prop-2-enylidene-2,7a-dihydrocyclopenta[b]pyran-6-one	present	NPASS
1'-OH-4-Keto-gamma-carotene/(Carotenoid K)	present	NPASS
Eupatin	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemonastrum obtusilobum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP476529.1 ↗437 bp

ACGT

AATCCGGCGCAGCTGCGTCAAGGAAAACTTACAGGAAACAAGGGGTCAGCCCCGGAAATCCTAATACTCAAACGACTCTCGGCAACGGAT …

Anemonastrum obtusilobum voucher Qin et al. 17013 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor23

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 6≤1 km 5≤10 km 3>10 km 3

17 georeferenced · 6 without coordinates

Open the mapobservation + sensor23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)