Anemonastrum narcissiflorum

(L.) Holub · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemonastrum

At a glance

Occurrence records4 493

Data sources10

Biological traits25

DNA specimens1

eDNA detections2

Sources10 archives

Databases and archives Anemonastrum narcissiflorum's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 493 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~8.76 Gbp↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources25 traits

Chemical compositionLOTUS · NPASS116 compounds

Occurrence & distributionGBIF4 493 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT8.8 Gbp

01Narrative

Anemonastrum narcissiflorum, the narcissus anemone or narcissus-flowered anemone, is a herbaceous perennial in the genus Anemonastrum and the buttercup family. Basionym: Anemone narcissiflora Hook. & Arn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology6

Plant height0.225 m

Plant height max1 m

Plant height min0.2 m

Seed mass6.89 mg

Seed mass max8.17 mg

Seed mass min3.22 mg

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal typewind

Flowering endJul

Flowering startMay

Life formperennial

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 700 m

Elevation mean2 275 m

Elevation min1 850 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest edges, meadows, shrubberies

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition116 compounds

Compounds documented for Anemonastrum narcissiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cardenolides53

Pregnane steroids27

Flavonols7

Furanoid lignans6

Oleanane triterpenoids5

Documented compounds116 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(1'S,2R,3'R,5'S,7'R,10'R,12'R,14'R,15'R,18'R,19'R,22'S,23'R)-10',22'-dihydroxy-7',18'-dimethyl-19'-(5-oxo-2H-furan-3-yl)spiro[1,3-thiazolidine-2,9'-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane]-14'-carbaldehyde	present	NPASS
(1S,3R,5S,6R,8R,10S,12R,14R,15S,18R,19R,22S,23R)-5,6,22-trihydroxy-8,18-dimethyl-19-(5-oxo-2H-furan-3-yl)-4,9,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,10R,12R,14R,15R,18R,19R,22S,23R)-10,22-dihydroxy-7,18-dimethyl-9-oxo-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,10R,12R,14R,15S,18R,19R,20R,22S,23R)-10,20,22-trihydroxy-7,18-dimethyl-9-oxo-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,8S,9R,10S,12R,14R,15S,18R,19R,22S,23R)-8,9,10,22-tetrahydroxy-7,18-dimethyl-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,9R,10S,12R,14R,15R,18R,19R,22S,23R)-9,10,22-trihydroxy-7,18-dimethyl-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,9R,12R,14R,15S,18R,19R,22S,23R)-9,22-dihydroxy-7,18-dimethyl-10-oxo-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,9.015,23.018,22]pentacosane-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,9S,10R,12R,14R,15R,18R,19R,22S,23R)-10,22-dihydroxy-7,18-dimethyl-19-(5-oxo-2H-furan-3-yl)spiro[4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-9,2'-5H-1,3-thiazole]-14-carbaldehyde	present	NPASS
(1S,3R,5S,7R,9S,10R,12R,14R,15S,18R,19R,20R,22S,23R)-10,20,22-trihydroxy-7,18-dimethyl-19-(5-oxo-2H-furan-3-yl)spiro[4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-9,2'-5H-1,3-thiazole]-14-carbaldehyde	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemonastrum narcissiflorum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX856770.1 ↗281 bpUSA · 2020

ACGT

TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCCTAGGCTTAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCTTCCCCAC …

Anemonastrum narcissiflorum isolate LLV4 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Anemonastrum narcissiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size8 757 590 816 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Anemonastrum narcissiflorum8.76 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type4 493 records

Wild obs. + sensor3 582

Museum / vouchered380

Cultivated / captive2

Other529

Range

Area of Occupancy AOO6 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 1 141≤1 km 790≤10 km 389>10 km 147

2 467 georeferenced · 1 115 without coordinates

Open the mapobservation + sensor3 582

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 15≤1 km 114≤10 km 150>10 km 2

281 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence380

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	103
Salzburg, AT	69
Oskarshamn, SE	21
BDBClocation not on record	16
LDlocation not on record	13
Moscow State Universitylocation not on record	9
Mlocation not on record	7
LfUlocation not on record	6
Musee des Dinosaures d'Esperaza (Aude)location not on record	6
DOI/NPS, Greenbelt Parklocation not on record	4
GZUlocation not on record	4
GJOlocation not on record	4
BClocation not on record	3
Sion, CH	3
Wlocation not on record	3
DOI/NPS, Colonial National Historical Parklocation not on record	2
Dresden, DE	2
Rocky Mountain Biological Laboratorylocation not on record	1
Bronx, US	1
Provincia di Livornolocation not on record	1
BRNUlocation not on record	1
BFLlocation not on record	1
inatura Erlebnis Naturschau GmbHlocation not on record	1
IWEP FEB RASlocation not on record	1
SLU Artdatabankenlocation not on record	1
Dekalb, US	1

26 institutions · 284 of 380 vouchered records shown · 96 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Anemonastrum narcissiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 2.10–9.30

Seasonal swing summer↔winter27.2 °C

Max temp (day)9.30 °C 5.40–13.1

Min temp (night)1.80 °C -2.00–5.50

Precipitation143 mm/mo 129–158

Air humidity60.7 % 60.5–60.9

Moisture balance53.2 mm/mo 24.0–82.4

Vapour deficit391 Pa 312–470

Wind speed4.10 m/s 2.30–5.90

Cloud cover52.7 % 45.0–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anemonastrum narcissiflorum

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Compound class profile5 classes

Documented compounds116 total

At a glance

Genome sizehow big the whole instruction manual is

Record type4 493 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 493 records