Anemonastrum flaccidum

(F.Schmidt) Mosyakin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Anemonastrum

At a glance

Occurrence records352

Data sources11

Biological traits19

DNA specimens0

eDNA detections3

Sources11 archives

Databases and archives Anemonastrum flaccidum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS203 compounds

Occurrence & distributionGBIF352 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT28 Gbp

01Narrative

Anemonastrum flaccidum, the flaccid anemone or soft windflower, is a plant species in the family Ranunculaceae. It is a perennial growing to 0.1 m (0ft 4in).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length55 mm

Leaf length max75 mm

Leaf length min35 mm

Leaf width102 mm

Leaf width max140 mm

Leaf width min65 mm

Plant height0.275 m

Plant height max0.4 m

Plant height min0.12 m

Life cycle & reproduction4

Flowering endJun

Flowering startApr

Life formperennial

Life spanperennial

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTsilty soil on the bank of rivulets

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition203 compounds

Compounds documented for Anemonastrum flaccidum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids33

Secoiridoid monoterpenoids18

Flavones10

Cinnamic acids and derivatives7

Iridoids monoterpenoids5

Documented compounds203 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-alpha-Pinene	present	NPASS
(-)-Linalool	present	NPASS
(-)-Sweroside	present	NPASS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2R)-2-hydroxy-N-[(E,2S,3S,5R,6S)-1,3,5,6-tetrahydroxyhexacos-9-en-2-yl]pentadecanamide	present	NPASS
(2R)-2-hydroxy-N-[(E,2S,3S,5R,6S)-1,3,5,6-tetrahydroxyoctacos-9-en-2-yl]octadecanamide	present	NPASS
(2R)-2-hydroxy-N-[(E,2S,3S,5R,6S)-3,5,6-trihydroxy-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyhexacos-9-en-2-yl]hexadecanamide	present	NPASS
(2R)-N-[(E,2S,3S,5R,6S)-1-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5,6-trihydroxyoctacos-9-en-2-yl]-2-hydroxyoctadecanamide	present	NPASS
(2R,6S,7aR)-2-[(2E,4E,6E,8E,10E,12E,14E)-15-[(2R,6S,7aR)-6-hydroxy-4,4,7a-trimethyl-2,5,6,7-tetrahydro-1-benzofuran-2-yl]-6,11-dimethylhexadeca-2,4,6,8,10,12,14-heptaen-2-yl]-4,4,7a-trimethyl-2,5,6,7-tetrahydro-1-benzofuran-6-ol	present	NPASS
(2S,3R,4S)-4-(carboxymethyl)-3-ethenyl-2-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-pyran-5-carboxylic acid	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anemonastrum flaccidum has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP476515.1 ↗454 bp

ACGT

AATCCGGCGCAACCAGCGTCAAGGAAAACTTAGCGGAAACAAGGCGTCGACCTGTAACAAGGAAGACACTGGAAATCCGAATACTCAAAC …

Anemonastrum flaccidum voucher Yang Q.E. & Q.Yuan 380 (PE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL7★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Anemonastrum flaccidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size28 019 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Anemonastrum flaccidum28.02 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–322n range14median14mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1412×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Starodubtzev, V. N. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 772.

CCDB · ipcn-api-dl — Nishikawa, T. 1985. Chromosome counts of flowering plants of Hokkaido (8). J. Hokkaido Univ. Educ., Sect. 2B 35: 97–111.

CCDB · ipcn-api-dl — Yang, Q. e. 2002. Cytology of ten species in Anemone, one in Anemoclema and six in Clematis (Trib. Anemoneae, Ranunculaceae) from China. Acta Phytotax. Sin. 40(5): 396–405.

CCDB · book-ipcn67-71 — ONO, R., & K. KIKUCHI. 1957. Chromosomes of Anemone flaccida Fr. Schm. Kromosomo 32: 1107-11 OS.

CCDB · book-ipcn67-71 — KURITA, M. 1957. Chromosome studies in Ranunculaceae I. Karyotypes of the subtribe Anemoninae. Rep. Biol. Inst. Ehime Univ. 1: 1-10.

CCDB · book-atlas-flowering-plants — M. &S.1935

CCDB · kew — Mabuchi T, Kokubun H, Mii M, Ando T. 2005. Nuclear DNA content in the genus Hepatica (Ranunculaceae). Journal of Plant Research 118: 37-41.

CCDB · Cave1956 — Kurita a

CCDB · Cave1956 — Kurita d

CCDB · Cave1958 — Kurita 1958

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Nishikawa, T. 1979. Chromosome counts of flowering plants of Hokkaido (2). Rep. Taisetsuzan Inst. Sci. 14: 15–23.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type352 records

Wild obs. + sensor348

Museum / vouchered4

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 184≤1 km 23≤10 km 15>10 km 57

279 georeferenced · 69 without coordinates

Open the mapobservation + sensor348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	4

1 institutions · 4 of 4 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Anemonastrum flaccidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)