Anelosimus vittatus

(C.L.Koch, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theridiidae/Anelosimus

At a glance

Occurrence records5 659

Data sources8

Biological traits16

DNA specimens97

eDNA detections237

Sources8 archives

Databases and archives Anelosimus vittatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 659 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI237 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

World Spider Trait DBMasaryk University16 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources16 traits

Occurrence & distributionGBIF5 659 records

Environmental DNA4 datasets · 9 countries237 detections

DNA & barcodingBOLD97 specimens

01Narrative

Anelosimus vittatus è un ragno appartenente alla famiglia Theridiidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Simonneau et al. 2016Macías-Hernández et al. 2020Entling et al. 2007Buchar & Růžička 2002Henriksen & Hilmo 2015Gajdoš & Svatoň 2001Gajdoš et al. 2014SLU 2020Bruun & Lissner 2019Liste France 2018Harvey et al. 2017Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀2.85·♂2.56 mm

Cephalothorax height♀0.39·♂0.32 mm

Cephalothorax length♀1.28·♂1.35 mm

Cephalothorax width♀1.06·♂1.04 mm

Fang length♀0.32·♂0.32 mm

Tibia I length♀1.36·♂1.68 mm

Predation1

Hunting guildspace web weavers

Ecology9

Ballooningyes

Circadian activity0.5 mm

Light0.75 mm

Light 2partly shaded

Moisture 10.5 mm

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratum0.81 mm

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anelosimus vittatus has left across the world's sequence archives.

At a glance

DNA specimens97

BINs2

Marker genes1

eDNA detections237

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus87 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

86Tvariable

293Cvariable

540Cmostly conserved

GATTATATTTAGTATTTGGAGCTTGAGCTGCAATAGTAGGAACTGCTATAAGAGTTTTAATTCGAATTGAATTAGGACAACCTGGTAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes12

BINs2

Most divergent pair6.9%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Theridion neomexicanumsame family13.3%Yunohamella lyricasame family13.9%Ameridion musawassame family14.1%Theridion ravumsame family14.4%Theridion frondeumsame family14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 659 records

Wild obs. + sensor5 008

Museum / vouchered631

Other20

Origin

Native28

Range

Area of Occupancy AOO11 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 1 492≤1 km 631≤10 km 2 291>10 km 46

4 460 georeferenced · 548 without coordinates

Open the mapobservation + sensor5 008

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 134≤1 km 18≤10 km 272>10 km 1

425 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence631

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	155
SLU Artdatabankenlocation not on record	107
Bonn, DE	35
Paro, BT	18
Frankfurt am Main	15
Zoologisches Museum Hamburglocation not on record	11
Tilburg, NL	10
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	8
Copenhagen, DK	7
Natural History Museum Rotterdamlocation not on record	7
Naturalis Biodiversity Centerlocation not on record	6
	5
Adam Mickiewicz University in Poznańlocation not on record	5
Cambridge, US	5
South Kensington, GB	3
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
SGAV-and-NHMDlocation not on record	3
Natural History Museum, Londonlocation not on record	2
ZSMlocation not on record	2
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	2
Barcelona, ES	2
NHMOlocation not on record	1
Museo Nacional de Ciencias Naturales (CSIC)location not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
SNSDlocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Akademia Pomorska w Słupskulocation not on record	1
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	1

28 institutions · 418 of 631 vouchered records shown · 213 without an institution code

09Environmental DNA237 detections

Where the DNA of Anelosimus vittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found237

Studies independent surveys4

Countries9

Verifiable raw sequence linked143

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 237 detections have coordinates

Open the map9 countries0

Wallhecke auf Laubzweigen1. Forest & Woodland|1.4. Temperate ForestsynanthropHeckentamarix roseauxPrairie

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 4.50–17.0

Seasonal swing summer↔winter17.0 °C

Max temp (day)15.1 °C 6.50–20.7

Min temp (night)8.40 °C 1.40–13.2

Precipitation65.4 mm/mo 42.9–94.5

Air humidity62.5 % 58.5–69.4

Moisture balance-9.40 mm/mo -61.3–59.1

Vapour deficit521 Pa 252–754

Wind speed4.00 m/s 2.60–5.30

Cloud cover47.8 % 40.0–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 237 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anelosimus vittatus

At a glance

Sources8 archives

Morphometry6

Predation1

Ecology9

At a glance

Record type5 659 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 659 records