Anelasmocephalus cambridgei

(Westwood, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Opiliones/Trogulidae/Anelasmocephalus

At a glance

Occurrence records1 424

Data sources6

Biological traits2

DNA specimens15

eDNA detections6

Sources6 archives

Databases and archives Anelasmocephalus cambridgei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 424 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD15 specimens

01Narrative

Anelasmocephalus cambridgei est une espèce d'opilions dyspnois de la famille des Trogulidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)predator

Feeding guild (larval)predator

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anelasmocephalus cambridgei has left across the world's sequence archives.

At a glance

DNA specimens15

BINs2

Marker genes2

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Diversity (π)4.2%

Haplotypes2

BINs2

Most divergent pair1.2%

Where individuals differ — all 92 variable positions, in barcode order

3Cmostly conserved

7Amostly conserved

10Tmostly conserved

13Cmostly conserved

19Cvariable

28Gmostly conserved

37Amostly conserved

38Gmostly conserved

39Cmostly conserved

46Avariable

50Tmostly conserved

57Tmostly conserved

58Amostly conserved

64Tmostly conserved

67Tmostly conserved

73Amostly conserved

74Cmostly conserved

82Amostly conserved

85Amostly conserved

88Gmostly conserved

100Amostly conserved

103Tmostly conserved

106Cmostly conserved

112Gmostly conserved

118Tmostly conserved

124Tmostly conserved

136Cmostly conserved

139Cmostly conserved

142Cmostly conserved

160Gmostly conserved

169Cmostly conserved

184Avariable

193Cmostly conserved

199Tmostly conserved

205Tmostly conserved

212Cmostly conserved

217Avariable

223Gmostly conserved

226Tmostly conserved

232Cvariable

238Tmostly conserved

241Amostly conserved

244Cmostly conserved

250Tmostly conserved

253Amostly conserved

262Gvariable

263Tmostly conserved

280Amostly conserved

283Amostly conserved

286Amostly conserved

301Tmostly conserved

302Amostly conserved

307Amostly conserved

310Amostly conserved

312Gmostly conserved

313Gmostly conserved

316Amostly conserved

337Gmostly conserved

343Tvariable

355Cmostly conserved

364Gmostly conserved

373Gmostly conserved

382Amostly conserved

394Cmostly conserved

415Cmostly conserved

424Tmostly conserved

433Amostly conserved

436Tmostly conserved

439Tmostly conserved

454Tmostly conserved

463Cmostly conserved

466Amostly conserved

469Cmostly conserved

478Gmostly conserved

508Gmostly conserved

514Tmostly conserved

520Tmostly conserved

532Gmostly conserved

533Tmostly conserved

538Tmostly conserved

547Cmostly conserved

562Gmostly conserved

565Amostly conserved

574Avariable

586Tmostly conserved

589Cmostly conserved

616Tmostly conserved

622Amostly conserved

640Tmostly conserved

643Amostly conserved

649Amostly conserved

655Tmostly conserved

TACCCTATATTTCATATTCGGCTTATGGTCAGCGATAGCAGGAACAGCCTTAAGCCTATTCATTCGTATAGAACTAGGACAACCAGGGGG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 424 records

Wild obs. + sensor914

Museum / vouchered510

Origin

Native6

Range

Area of Occupancy AOO2 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 365≤1 km 98≤10 km 247>10 km 7

717 georeferenced · 197 without coordinates

Open the mapobservation + sensor914

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 2≤1 km 10≤10 km 13

25 georeferenced · 485 without coordinates

Open the institutions mapphysical evidence510

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	233
BOSlocation not on record	126
SNSB-Zoologische Staatssammlung Münchenlocation not on record	70
Frankfurt am Main	21
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	13
SNSDlocation not on record	6
Cambridge, US	4
Bavarian State Collection of Zoologylocation not on record	4
Bonn, DE	4
ZSMlocation not on record	3
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	1

12 institutions · 487 of 510 vouchered records shown · 23 without an institution code

09Environmental DNA6 detections

Where the DNA of Anelasmocephalus cambridgei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Mischwald oberhalb der Wiesbachaue in Moos u…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 8.70–14.5

Seasonal swing summer↔winter15.0 °C

Max temp (day)15.5 °C 12.8–18.1

Min temp (night)7.60 °C 3.90–10.0

Precipitation55.1 mm/mo 52.2–58.7

Air humidity61.8 % 59.1–62.8

Moisture balance-42.6 mm/mo -56.7–-11.8

Vapour deficit556 Pa 472–629

Wind speed3.90 m/s 3.50–4.20

Cloud cover43.8 % 39.5–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anelasmocephalus cambridgei

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 424 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 424 records