Aneilema biflorum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Aneilema

At a glance

Occurrence records543

Data sources6

Biological traits25

DNA specimens1

eDNA detections0

Sources6 archives

Databases and archives Aneilema biflorum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility543 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF543 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Aneilema biflorum is a perennial herb in the Commelinaceae family. It grows in moist and shaded places, often near streams in eastern Australia. A ground covering plant, growing to 20 cm tall. White flowers occur between December and March. The wrinkled fruit is flattened, 4 mm long, with pale grey seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length4 mm

Leaf length35 mm

Leaf length max50 mm

Leaf length min20 mm

Leaf width10 mm

Leaf width max15 mm

Leaf width min5 mm

Plant height max0.2 m

Life cycle & reproduction5

Flowering endMar

Flowering startDec

Flowering timeyyynnnnnnnny

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_elliptical

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneilema biflorum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR165400.1 ↗1 437 bpAustralia · 2016

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATA …

Aneilema biflorum voucher PIF43583 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type543 records

Wild obs. + sensor426

Museum / vouchered105

Other12

Origin

Native21

Range

Area of Occupancy AOO1 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 322≤1 km 35≤10 km 18>10 km 10

385 georeferenced · 41 without coordinates

Open the mapobservation + sensor426

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 47≤1 km 4≤10 km 24>10 km 9

84 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	50
Mount Annan, AU	21
Armidale, AU	8
Museo Entomologico de Leonlocation not on record	6
Canberra, AU	5
Paris, FR	2
Kew, GB	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	2
Université de Strasbourglocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

11 institutions · 101 of 105 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)