Aneilema aequinoctiale

(P.Beauv.) G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Aneilema

At a glance

Occurrence records935

Data sources6

Biological traits15

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Aneilema aequinoctiale's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility935 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF935 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 60

01Narrative

Aneilema aequinoctiale est une espèce de pseudo-arbuste à fleurs de la famille des Commelinaceae. Elle est originaire d'Afrique de l'Ouest et d'Afrique de l'Est.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height1.5 m

Plant height max1.83 m

Plant height min0.3 m

Life cycle & reproduction3

Life formscrambling subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneilema aequinoctiale has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON950843.1 ↗755 bpKenya · 2014

ACGT

ATTATACTCCTGAGATAATAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCGCCTGAGGAAGCAG …

Aneilema aequinoctiale voucher PE CPG28627 Z.D. Chen et al. 28627 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aneilema aequinoctiale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records60–602n range60median60mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 603×CCDB · book-ipcn66 · CCDB · book-ipcn72 · CCDB · book-ipcn73-74

CCDB · book-ipcn66 — Morton 1966

CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.C. 1973. Chromosome numbers in Malawian Commelinaceae. Bot. J. Linn. Soc. 66: 303-306.

n 301×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HEITZ, B. 1969. Commelinacees. Inf. Ann. Caryosyst. et Cytogenet. 3: 9-12.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type935 records

Wild obs. + sensor761

Museum / vouchered174

Range

Area of Occupancy AOO1 460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 435≤1 km 170≤10 km 25>10 km 3

633 georeferenced · 128 without coordinates

Open the mapobservation + sensor761

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 2≤10 km 1

5 georeferenced · 169 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	67
Kew, GB	32
TAFORI-LSRClocation not on record	10
Saint Louis, US	8
Dresden, DE	3
Uppsala, SE	2
Yaoundé, CM	1
CJBGlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Frankfurt am Main	1
LDlocation not on record	1
GZUlocation not on record	1

12 institutions · 128 of 174 vouchered records shown · 46 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)