Aneilema acuminatum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Aneilema

At a glance

Occurrence records1 758

Data sources8

Biological traits31

DNA specimens3

eDNA detections4

Sources8 archives

Databases and archives Aneilema acuminatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 758 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF1 758 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 30

01Narrative

أنيليمة مستدقة هي نوع من النباتات تتبع جنس الأنيليمة من الفصيلة الوعلانية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length4 mm

Leaf length70 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf mass per area62.15 g/m2

Leaf size403 mm²

Leaf width17.5 mm

Leaf width max25 mm

Leaf width min10 mm

Plant height0.4 m

Plant height max0.4 m

Seed mass0.561 mg

⚠ sources differ — TRY: 0.561 mg · AusTraits: 0.912 mg · GIFT: 0.56 mg

Seed mass max0.56 mg

Seed mass min0.56 mg

Life cycle & reproduction6

Dispersal typeself

Flowering endJan

Flowering startAug

Flowering timeyyyyyyynnnyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_ovate

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aneilema acuminatum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496588.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTTAAAGCGGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTACATAACCAAGGATACTGATATATTGGCAGCA …

Aneilema acuminatum isolate BATT145-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aneilema acuminatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–322n range31median30mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Morton 1966

CCDB · book-ipcn66 — Guervin & Le Coq 1966a

CCDB · book-fedorov — Morton J. K. 1966

2n 323×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn66 — Briggs 1966

CCDB · book-ipcn67-71 — LEWIS, w. H.' Y. SUDA, & R. L. OLIVER. 1967. In Chromosome numbers of phanerogams. 2. Ann. Missouri Bot. Gard. 54: 178-181.

CCDB · book-fedorov — Briggs 1966

n 121×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HEITZ, B. 1967 Cornrnelinacees. Inf. Ann. Caryosyst. et Cytogenet. 1: 17-21.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.962 ↗

08Occurrence & distribution

Record type1 758 records

Wild obs. + sensor1 319

Museum / vouchered322

Cultivated / captive2

Other115

Origin

Native48

Introduced6

Range

Area of Occupancy AOO4 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 946≤1 km 114≤10 km 51>10 km 35

1 146 georeferenced · 173 without coordinates

Open the mapobservation + sensor1 319

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 78≤1 km 40≤10 km 115>10 km 36

269 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence322

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	99
Museo Entomologico de Leonlocation not on record	53
Mount Annan, AU	51
Canberra, AU	30
Smithfield, AU	24
Armidale, AU	13
Kew, GB	11
Adelaide, AU	7
John T. Waterhouse Herbariumlocation not on record	5
Palmerston, AU	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Wollongong, AU	2
James Cook Townsvillelocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Honolulu, US	1
University of Stellenboschlocation not on record	1
Australian Tropical Herbariumlocation not on record	1

17 institutions · 307 of 322 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Aneilema acuminatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 17.9–24.9

Seasonal swing summer↔winter11.4 °C

Max temp (day)26.7 °C 23.2–28.9

Min temp (night)15.2 °C 13.0–20.9

Precipitation72.5 mm/mo 31.2–302

Air humidity58.1 % 47.6–65.5

Moisture balance-42.5 mm/mo -115–120

Vapour deficit1,047 Pa 875–1,459

Wind speed2.40 m/s 1.30–3.60

Cloud cover24.2 % 19.8–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aneilema acuminatum

At a glance

Sources8 archives

Size & morphology14

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 758 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 758 records