Anegleis cardoni

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Anegleis

At a glance

Occurrence records456

Data sources7

Biological traits0

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Anegleis cardoni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility456 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF456 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

Genome at a glanceGoaT2n = 20

01Narrative

Anegleis cardoni, is a species of lady beetle found in India, Pakistan and Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anegleis cardoni has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.97%

Haplotypes2

BIN1

Most divergent pair1.2%

Where individuals differ — all 11 variable positions, in barcode order

20Gvariable

23Cvariable

24Tvariable

100Avariable

178Cmostly conserved

217Tvariable

220Tvariable

278Tvariable

286Cmostly conserved

316Tvariable

565Avariable

AACTTTATATTTCATATTTGGGCTTTGAGCAGGTATAGTAGGTACCTCTCTTAGAATTTTAATTCGTCTTGAATTAAGATCAACAAATAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Micraspis discolorsame family14.5%Myrrha octodecimguttatasame family14.8%Coelophora bissellatasame family15.5%Calvia quatuordecimguttatasame family15.5%Chilocorus renipustulatussame family16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anegleis cardoni carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type456 records

Wild obs. + sensor453

Museum / vouchered3

Range

Area of Occupancy AOO1 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 137≤1 km 130≤10 km 43>10 km 24

334 georeferenced · 119 without coordinates

Open the mapobservation + sensor453

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Institute for Biotechnology and Genetic Engineeringlocation not on record	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Anegleis cardoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 18.1–29.7

Seasonal swing summer↔winter21.1 °C

Max temp (day)30.2 °C 24.4–36.4

Min temp (night)16.5 °C 11.1–21.7

Precipitation24.4 mm/mo 20.3–27.9

Air humidity52.0 % 45.4–52.4

Moisture balance-83.7 mm/mo -153–-66.1

Vapour deficit1,389 Pa 1,015–2,376

Wind speed2.10 m/s 2.00–2.40

Cloud cover31.1 % 25.2–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)