Anegcephalesis arctella

Ragonot, 1887 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Anegcephalesis

At a glance

Occurrence records6

Data sources7

Biological traits0

DNA specimens7

eDNA detections2

Sources7 archives

Databases and archives Anegcephalesis arctella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD7 specimens

01Narrative

Anegcephalesis is a genus of snout moths described by Harrison Gray Dyar Jr. in 1917. It contains the species A. arctella described by Émile Louis Ragonot in 1887. It is found in North America, with a wingspan about 23 mm. The genus also contains Anegcephalesis cathaeretes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anegcephalesis arctella has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections2

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.3%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 53 variable positions, in barcode order

31Amostly conserved

32Gmostly conserved

34Amostly conserved

55Amostly conserved

68Gmostly conserved

70Cmostly conserved

79Amostly conserved

82Tmostly conserved

85Amostly conserved

88Tmostly conserved

91Cmostly conserved

115Cmostly conserved

130Tmostly conserved

139Tmostly conserved

200Gmostly conserved

217Amostly conserved

235Tmostly conserved

271Tmostly conserved

274Cmostly conserved

283Amostly conserved

284Tmostly conserved

322Amostly conserved

337Amostly conserved

340Cvariable

347Cmostly conserved

354Cmostly conserved

364Cmostly conserved

367Tmostly conserved

368Gmostly conserved

397Cmostly conserved

401Tmostly conserved

403Amostly conserved

406Tmostly conserved

433Amostly conserved

460Tmostly conserved

514Tmostly conserved

517Amostly conserved

548Tmostly conserved

550Amostly conserved

556Amostly conserved

557Tmostly conserved

559Amostly conserved

565Tmostly conserved

577Amostly conserved

578Tmostly conserved

586Tmostly conserved

616Cmostly conserved

619Amostly conserved

622Cmostly conserved

628Amostly conserved

634Cmostly conserved

637Tmostly conserved

658Tmostly conserved

AACTCTATACTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGACTTTTAATTCGAGCCGAATTAGGAACTCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Zamagiria australellasame family6.2%Nephopterix placoxanthasame family6.4%Merulempista brucellasame family7.0%Zamagiria laidionsame family7.3%Cherchera abatesellasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type6 records

Museum / vouchered6

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence6

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	4
Mississippi State, US	2

2 institutions · 6 of 6 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Anegcephalesis arctella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)