Androstephium coeruleum

(Scheele) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Androstephium

At a glance

Occurrence records454

Data sources9

Biological traits10

DNA specimens4

eDNA detections4

Sources9 archives

Databases and archives Androstephium coeruleum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF454 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Androstephium coeruleum, commonly called blue funnel-lily, is a herbaceous perennial growing from corms. It has light blue to violet purple flowers and grows up to 35 cm tall. It is found growing in prairies and on grassy slopes in its native range within Texas, Oklahoma and Kansas of the United States.Flora of North America, Vol. 26 Page 333 Androstephium coeruleum (Scheele) Greene, Pittonia. 2: 57. 1890.Biota of North America Program, 2013 county distribution map, Androstephium caeruleum It disperses its seed by wind.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Androstephium coeruleum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ273929.1 ↗1 428 bp

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAA …

Androstephium coeruleum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

08Occurrence & distribution

Record type454 records

Wild obs. + sensor341

Museum / vouchered113

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 171≤1 km 32≤10 km 5>10 km 51

259 georeferenced · 82 without coordinates

Open the mapobservation + sensor341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 15≤1 km 22≤10 km 55>10 km 9

101 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	58
Austin, US	12
BAYLUlocation not on record	9
Fort Worth, US	7
Lubbock, US	6
Chongqing Museumlocation not on record	4
EL PASO, US	3
Bangkok, TH	2
Stephenville, US	2
Denton, US	2
Canadian Department of Agriculturelocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Fullerton, US	1
Tempe, US	1
Flagstaff, US	1
Claremont, US	1
San Angelo, US	1

17 institutions · 112 of 113 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Androstephium coeruleum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)