Andropolia diversilineata

Grote, 1877 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Andropolia

At a glance

Occurrence records407

Data sources7

Biological traits0

DNA specimens18

eDNA detections18

Sources7 archives

Databases and archives Andropolia diversilineata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF407 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD18 specimens

01Narrative

Andropolia diversilineata is a moth in the family Noctuidae first described by Augustus Radcliffe Grote in 1877. It is found in western North America, from British Columbia south to California. The wingspan is about 44 mm. Adults are on wing in late summer. The larvae feed on Purshia tridentata.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andropolia diversilineata has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

59Cmostly conserved

211Gmostly conserved

238Tmostly conserved

274Tmostly conserved

287Tmostly conserved

334Gvariable

367Cmostly conserved

400Cmostly conserved

508Tmostly conserved

556Cmostly conserved

577Amostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.32%

Haplotypes7

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cosmia moderatasame family4.2%Andropolia aedonsame genus4.3%Bryophila rectilineasame family4.4%Eremohadena marianasame family4.6%Enargia infumatasame family4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type407 records

Wild obs. + sensor20

Museum / vouchered387

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 2≤1 km 3≤10 km 9>10 km 4

18 georeferenced · 2 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 17≤1 km 47≤10 km 116>10 km 34

214 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence387

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	85
Colorado State Universitylocation not on record	68
New Haven, US	52
ASUlocation not on record	36
University of Alberta Museums (UAM)location not on record	34
San Diego, US	25
East Lansing, US	18
Mississippi State, US	15
Denver, US	13
Helsinki, FI	7
Vernal, US	5
US	5
St. Paul, US	4
WWUlocation not on record	4
Albuquerque, US	3
University of California, Davislocation not on record	2
Champaign, US	1

17 institutions · 377 of 387 vouchered records shown · 10 without an institution code

09Environmental DNA18 detections

Where the DNA of Andropolia diversilineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 16.8–22.4

Seasonal swing summer↔winter20.4 °C

Max temp (day)24.5 °C 24.2–30.2

Min temp (night)10.4 °C 9.90–14.3

Precipitation12.9 mm/mo 6.70–27.3

Air humidity47.8 % 40.8–48.0

Moisture balance-142 mm/mo -157–-126

Vapour deficit1,025 Pa 988–1,562

Wind speed2.40 m/s 1.90–3.20

Cloud cover13.4 % 13.3–18.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)