Andropogon virginicus
speciesAt a glance
Occurrence records7 684
Data sources10
Biological traits113
DNA specimens8
eDNA detections7
Sources10 archives
Databases and archives Andropogon virginicus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 684 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources113 traits
Occurrence & distributionGBIF7 684 records
Environmental DNA2 datasets · 2 countries7 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Борода́ч вирги́нский — вид цветковых растений рода Бородачевник (Andropogon) семейства Злаки (Poaceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsUSDATRY
Size & morphology10
Leaf length300 mm
Leaf length max130 mm
Leaf width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 3 mm
Leaf width max5 mm
Leaf width min2 mm
Plant height0.91 m
⚠ sources differ — GIFT: 0.91 m · AusTraits: 1 m · USDA: 0.914 m · TRY: 0.433 m
Plant height max1 m
Seed mass0.3 mg
⚠ sources differ — TRY: 0.3 mg · GIFT: 0.431 mg
Seed mass max0.33 mg
Seed mass min0.26 mg
Life cycle & reproduction32
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessevergreen
Flower colouryellow
Flower conspicuousNo
Flowering endOct
Flowering startAug
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDASlow
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproductive maturity1 years
Resprout abilityNo
Resprouting capacityresprouts
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSummer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: herb
Growth form USDABunch
Habitat GIFTforest, open, riparian
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min135 days
Leaf dry-matter content (LDMC)400 mg/g
Leaf n13.3 mg/g
Leaf p1 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max45 in
Precipitation min30 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7 pH
Soil pH min4.9 pH
Specific leaf area (SLA)12.12 mm²/mg
Temperature min-18 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound800 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andropogon virginicus has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes5
GenBank sequences10
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCAA …
Anatherum virginicum voucher CCDB-23308-H02 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Andropogon virginicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 201×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Church 1936
n 103×CCDB · ipcn-api-dl · CCDB · Cave1956
CCDB · ipcn-api-dl — Campbell, C. S. 1983. Systematics of the Andropogon virginicus complex (Gramineae). J. Arnold Arbor. 64: 171–254.
CCDB · Cave1956 — Gould
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 684 records
Wild obs. + sensor4 654
Museum / vouchered2 994
Cultivated / captive4
Fossil1
Other31
Origin
Native4
Introduced4 373
Range
Area of Occupancy AOO17 160 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy96% within 1 km
≤100 m 3 382≤1 km 854≤10 km 141>10 km 13
4 390 georeferenced · 264 without coordinates
Open the mapobservation + sensor4 654
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 202≤1 km 358≤10 km 607>10 km 219
1 386 georeferenced · 1 608 without coordinates
Open the institutions mapphysical evidence2 994
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions124 of 186 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 186 |
| Bronx, US | 159 |
| Sanda, JP | 154 |
| Chongqing Museumlocation not on record | 134 |
| Odawara, JP | 133 |
| Bangkok, TH | 95 |
| Jena Microbial Resource Collectionlocation not on record | 90 |
| Miami, US | 88 |
| Bloomington, US | 85 |
| Brisbane, AU | 66 |
| Kochi, JP | 66 |
| Wuzhou, CN | 59 |
| Chiba, JP | 58 |
| Saint Louis, US | 55 |
| College Park, US | 52 |
| University of Stellenboschlocation not on record | 46 |
| Austin, US | 45 |
| Kew, GB | 41 |
| Fort Worth, US | 40 |
| Davis, US | 38 |
| Nagano City, JP | 37 |
| Bando, JP | 35 |
| Williamsburg, US | 33 |
| Ann Arbor, US | 33 |
| Columbia, US | 33 |
| Durango, MX | 33 |
| Mount Annan, AU | 31 |
| Tsukuba, JP | 31 |
| New Haven, US | 28 |
| Toyama, JP | 27 |
| Canberra, AU | 26 |
| Auckland, NZ | 25 |
| KURAlocation not on record | 24 |
| Kawasaki Shi Tama Ku, JP | 23 |
| Norfolk, US | 22 |
| Chapel Hill, US | 19 |
| Canadian Department of Agriculturelocation not on record | 19 |
| Knoxville, US | 18 |
| Tall Timbers Research Stationlocation not on record | 18 |
| Tuscaloosa, US | 18 |
| Tomioka, JP | 16 |
| Tokushima, JP | 16 |
| Museo Entomologico de Leonlocation not on record | 15 |
| Fukushima Universitylocation not on record | 15 |
| Fayetteville, US | 15 |
| Staten Island, US | 15 |
| Tampa, US | 14 |
| Allentown, US | 14 |
| Tempe, US | 13 |
| US | 13 |
| Millersville, US | 12 |
| Flagstaff, US | 12 |
| Philadelphia, US | 12 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 12 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 12 |
| Pittsburg, US | 12 |
| Ishikawa Museum of Natural Historylocation not on record | 11 |
| BAYLUlocation not on record | 11 |
| University of Southern Mississippilocation not on record | 10 |
| Mexico City, MX | 10 |
| Clemson, US | 10 |
| Western Carolina Universitylocation not on record | 10 |
| Hiratsuka City Museumlocation not on record | 10 |
| Sagamihara, JP | 10 |
| Valdosta State Universitylocation not on record | 10 |
| EL PASO, US | 9 |
| Armidale, AU | 9 |
| University of Tennessee at Chattanoogalocation not on record | 9 |
| National Biodiversity Institute, Costa Ricalocation not on record | 9 |
| Denton, US | 9 |
| Torreón, MX | 8 |
| AUAlocation not on record | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 8 |
| Asheville, US | 8 |
| Christchurch, NZ | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| Mississippi State, US | 8 |
| Dekalb, US | 7 |
| Honolulu, US | 7 |
| J.F.Oberlin Universitylocation not on record | 7 |
| Logan, US | 6 |
| GAlocation not on record | 6 |
| Burlington, US | 6 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 6 |
| Mérida, MX | 6 |
| San Angelo, US | 6 |
| Moscow State Universitylocation not on record | 5 |
| Rotorua, NZ | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Beijing, CN | 5 |
| Claremont, US | 5 |
| CASlocation not on record | 5 |
| Riverside, US | 5 |
| Provo, US | 5 |
| Dover, US | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| ASUlocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Batemans Bay, AU | 4 |
| University of New Hampshirelocation not on record | 4 |
| Edinburgh, GB | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| Richmond, US | 4 |
| Morelia, MX | 4 |
| Nishihara, JP | 4 |
| Osaka, JP | 4 |
| Johnson City, US | 3 |
| Santa Barbara, US | 3 |
| Sendai, JP | 3 |
| KOMlocation not on record | 3 |
| Wollongong, AU | 3 |
| Wellington, NZ | 3 |
| Fairfax, US | 3 |
| Conway, US | 3 |
| Mexico City, MX | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Shinshu Universitylocation not on record | 2 |
| San Francisco de Campeche, MX | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Davenport, US | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| US | 2 |
| Edmonton, CA | 2 |
| Vancouver, CA | 2 |
| JP | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Moscow, US | 2 |
| Adelaide, AU | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Chicago, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Mount Berry, US | 2 |
| Denver, US | 2 |
| Lubbock, US | 2 |
| Montréal, CA | 2 |
| Fullerton, US | 1 |
| Boise, US | 1 |
| Phoenix, US | 1 |
| La Paz, MX | 1 |
| Chicago, US | 1 |
| MEXUlocation not on record | 1 |
| GB | 1 |
| California Academy of Scienceslocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Barcelona, ES | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| León, NI | 1 |
| San Luis Obispo, US | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Conway, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Whitehorse, CA | 1 |
| Nanjing, CN | 1 |
| Due West, US | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Paris, FR | 1 |
| Puebla, MX | 1 |
| US | 1 |
| Mexico City, MX | 1 |
| Long Beach, US | 1 |
| Walla Walla, US | 1 |
| Smithfield, AU | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Albuquerque, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| New Brunswick, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Macomb, US | 1 |
| South Kensington, GB | 1 |
| Kingston, US | 1 |
| US | 1 |
| Chicago, US | 1 |
| Coastal Carolina Universitylocation not on record | 1 |
186 institutions · 2 907 of 2 994 vouchered records shown · 87 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Andropogon virginicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys2
Countries2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map2 countries0
Growing at back of property in disturbed old…old field dominated by grasses, Solidago and…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.0 °C 14.0–21.0
Seasonal swing summer↔winter12.3 °C
Max temp (day)25.9 °C 17.2–25.9
Min temp (night)16.1 °C 11.7–16.1
Precipitation167 mm/mo 94.4–167
Air humidity58.7 % 58.7–60.8
Moisture balance9.90 mm/mo 3.80–27.4
Vapour deficit1,021 Pa 638–1,021
Wind speed4.70 m/s 4.30–4.70
Cloud cover36.6 % 36.0–45.7
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.