Andropogon longiberbis

Hack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Andropogon

At a glance

Occurrence records197

Data sources6

Biological traits8

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Andropogon longiberbis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility197 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF197 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Andropogon longiberbis là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Hack. mô tả khoa học đầu tiên năm 1885.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andropogon longiberbis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX397690.1 ↗516 bp

ACGT

TTGACTTACTACACCCCGGAGTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCTCGGGGTTCCGCCTGAA …

Anatherum longiberbe voucher Easley 1099 (FLAS) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Andropogon longiberbis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Campbell, C. S. 1983. Systematics of the Andropogon virginicus complex (Gramineae). J. Arnold Arbor. 64: 171–254.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type197 records

Museum / vouchered197

Range

Area of Occupancy AOO476 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 5≤10 km 7>10 km 42

54 georeferenced · 143 without coordinates

Open the institutions mapphysical evidence197

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	45
Miami, US	43
Tampa, US	37
Bronx, US	22
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	13
Tall Timbers Research Stationlocation not on record	8
Saint Louis, US	7
Bloomington, US	7
Kew, GB	3
GAlocation not on record	2
Knoxville, US	2
Logan, US	1
Philadelphia, US	1
Denver, US	1
Auckland, NZ	1
Cambridge, US	1
Bangkok, TH	1
Valdosta State Universitylocation not on record	1

18 institutions · 196 of 197 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)