Andropogon hallii

Hack. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Andropogon

At a glance

Occurrence records708

Data sources11

Biological traits95

DNA specimens25

eDNA detections9

Sources11 archives

Databases and archives Andropogon hallii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility708 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources95 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF708 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI25 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Andropogon hallii (лат.) — вид цветковых растений рода Бородачевник (Andropogon) семейства Злаки (Poaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height1.9 m

Seed mass3.67 mg

⚠ sources differ — TRY: 3.67 mg · GIFT: 4.12 mg

Seed mass max4.7 mg

Seed mass min2.4 mg

Life cycle & reproduction25

After harvest regrowth rateModerate

Bloom periodMid Summer

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formhemicryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateRapid

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSummer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsNo

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza typearbuscular

Root depth min20 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry22

Anaerobic toleranceMedium

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementHigh

Fire resistantNo

Fire toleranceHigh

Frost free days min120 days

Leaf c435 mg/g

Leaf n10.87 mg/g

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC4

Precipitation max30 in

Precipitation min10 in

Protein potentialMedium

Salinity toleranceLow

Shade toleranceHigh

Soil pH max8.4 pH

Soil pH min5.6 pH

Temperature min-30.5 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound96 640 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

03Chemical composition3 compounds

Compounds documented for Andropogon hallii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Fatty alcohols $ Oxygenated hydrocarbons1

Oxygenated hydrocarbons1

Hydroxy fatty acids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(5R)-5-hydroxytritriacontane-12,14-dione	present	LOTUS
methyl (8R)-8-hydroxydodecanoate	present	LOTUS
Tritriacontane-12,14-dione	present	LOTUS

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andropogon hallii has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes6

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216713.1 ↗296 bpCanada · 1951

ACGT

GAGGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCAAAAGACACTCTCAACCCACCCGTGGGGAGGGGACGTGGTGTTTGGCC …

Andropogon hallii voucher CCDB-28092-C09 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL5★rbcLa★ITS5★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Andropogon hallii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records60–602n range60median60mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 602×CCDB · ipcn-api-dl · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Riley, R. D. & K. P. Vogel. 1982. Chromosome numbers of released cultivars of switchgrass, indiangrass, big bluestem and sand bluestem. Crop Sci. (Madison) 22: 1082–1083.

CCDB · book-indian_vol2 — Reeder, J.R. 1977

n 302×CCDB · book-ipcn75-78 · CCDB · Cave1956

CCDB · book-ipcn75-78 — Reeder 1977

CCDB · Cave1956 — Gould

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type708 records

Wild obs. + sensor176

Museum / vouchered523

Other9

Origin

Native2

Range

Area of Occupancy AOO2 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 80≤1 km 22≤10 km 8>10 km 13

123 georeferenced · 53 without coordinates

Open the mapobservation + sensor176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 37≤1 km 117≤10 km 162>10 km 48

364 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence523

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	159
Chadron, US	52
DOI/NPS, Colonial National Historical Parklocation not on record	44
Denver, US	26
Fort Worth, US	26
DOI/NPS, Greenbelt Parklocation not on record	24
Lincoln, US	23
Albuquerque, US	19
Logan, US	15
Musee des Dinosaures d'Esperaza (Aude)location not on record	13
WINlocation not on record	13
Moscow, US	10
Bloomington, US	8
Missoula, US	8
ASUlocation not on record	7
Flagstaff, US	7
Saint Louis, US	6
University of Stellenboschlocation not on record	6
Austin, US	5
Bozeman, US	5
Chongqing Museumlocation not on record	5
Phoenix, US	4
Auckland, NZ	4
International Salmonella Centre (W.H.O.)location not on record	3
Fayetteville, US	2
Pullman, US	2
University of Winnipeglocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Oskarshamn, SE	2
University of Alberta Museumslocation not on record	2
St. Paul, US	2
Lubbock, US	1
Canadian Department of Agriculturelocation not on record	1
Davenport, US	1
US	1
Weber State Universitylocation not on record	1
Provo, US	1
Columbia, US	1
Corvallis, US	1
Ann Arbor, US	1
USFSlocation not on record	1
Knoxville, US	1
Boise, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
BAYLUlocation not on record	1
Karlsruhe, DE	1
EL PASO, US	1
Macomb, US	1

48 institutions · 523 of 523 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Andropogon hallii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

sandy soilsandprairie sandhillsdry, sandy clearings in dune areaFoliage white-glaucous; plants in loose colo…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)