Andropogon glomeratus
(Walter) Britton, Sterns & Poggenb. · speciesAt a glance
Occurrence records2 166
Data sources11
Biological traits99
DNA specimens10
eDNA detections5
Sources11 archives
Databases and archives Andropogon glomeratus's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 158 records↗
OBISOcean Biodiversity Information System8 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources99 traits
Occurrence & distributionGBIF · OBIS2 166 records
Environmental DNA1 datasets · 1 countries5 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Andropogon glomeratus is a species of grass known by the common names bushy bluestem and bushy beardgrass. This bunchgrass is native to the Americas, where it is widespread. It has also naturalized in other areas. The genus name Andropogon comes from the Greek words 'aner' or 'andros' meaning "man" and 'pogon' meaning "beard", in reference to the hairs on the spikelets of certain species in this genus. The specific epithet glomeratus means "bunched", in reference to the species' bushy and broom-like inflorescences.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTUSDATRY
Size & morphology4
Plant height1.9 m
Seed mass0.37 mg
⚠ sources differ — TRY: 0.37 mg · GIFT: 1.29 mg
Seed mass max0.41 mg
Seed mass min0.33 mg
Life cycle & reproduction25
After harvest regrowth rateModerate
Bloom periodLate Summer
Coppice potentialNo
Dispersal typeanimal
Flower colourwhite
Flower conspicuousNo
Fruit seed period beginFall
Fruit seed period endWinter
Growth rate USDAModerate
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassYes
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min160 days
Leaf n15.3 mg/g
Leaf p0.673 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max70 in
Precipitation min35 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max6.3 pH
Soil pH min5 pH
Specific leaf area (SLA)22.19 mm²/mg
Temperature min-23 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound205 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max18 000 per acre
Planting density min11 000 per acre
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andropogon glomeratus has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes5
GenBank sequences10
eDNA detections5
Countries1
The DNA barcodea real sequence read deposited for this species
AAGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAACCAAAGATACTGATATCTTGGCAGC …
Andropogon glomeratus voucher MCF-306 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL7★rbcLa★ITS★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Andropogon glomeratus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–202n range20median20mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 202×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-atlas-flowering-plants — Brown 1950
n 105×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · Cave1956
CCDB · ipcn-api-dl — Campbell, C. S. 1983. Systematics of the Andropogon virginicus complex (Gramineae). J. Arnold Arbor. 64: 171–254.
CCDB · ipcn-api-dl — Campbell, C. S. 1983. Wind dispersal of some North American species of Andropogon (Gramineae). Rhodora 85: 65–72.
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers, meiotic behavior, and notes on some grasses from Central America and the West Indies. Canad. J. Bot. 50: 1441-1452.
CCDB · Cave1956 — Gould
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 166 records
Wild obs. + sensor20
Museum / vouchered2 136
Other10
Origin
Native30
Range
Area of Occupancy AOO5 760 km²
Depth
0–200 m sunlit8
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 0.5 m · max 0.5 m · 8 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 8
10 georeferenced · 10 without coordinates
Open the mapobservation + sensor20
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 526≤1 km 212≤10 km 295>10 km 123
1 156 georeferenced · 980 without coordinates
Open the institutions mapphysical evidence2 136
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions104 of 158 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 215 |
| Saint Louis, US | 124 |
| Mexico City, MX | 120 |
| University of Stellenboschlocation not on record | 119 |
| Austin, US | 102 |
| Philadelphia, US | 93 |
| Chongqing Museumlocation not on record | 79 |
| Bronx, US | 66 |
| Miami, US | 65 |
| National Biodiversity Institute, Costa Ricalocation not on record | 60 |
| Fort Worth, US | 51 |
| Bangkok, TH | 42 |
| Mérida, MX | 39 |
| Riverside, US | 36 |
| Claremont, US | 34 |
| Jena Microbial Resource Collectionlocation not on record | 33 |
| Phoenix, US | 30 |
| Flagstaff, US | 30 |
| ASUlocation not on record | 29 |
| Chapel Hill, US | 29 |
| Williamsburg, US | 23 |
| Bloomington, US | 21 |
| BAYLUlocation not on record | 19 |
| Davis, US | 19 |
| Denton, US | 18 |
| Tapachula, MX | 18 |
| California Academy of Scienceslocation not on record | 18 |
| Philadelphia, US | 16 |
| College Park, US | 16 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| Columbia, US | 16 |
| US | 14 |
| San Angelo, US | 14 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 13 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 13 |
| Ann Arbor, US | 12 |
| EL PASO, US | 12 |
| Auckland, NZ | 11 |
| Wuzhou, CN | 11 |
| Tall Timbers Research Stationlocation not on record | 10 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 10 |
| Kew, GB | 9 |
| Tuscaloosa, US | 9 |
| San José, CR | 9 |
| Sanda, JP | 9 |
| Austin, US | 8 |
| La Paz, MX | 8 |
| Logan, US | 8 |
| GAlocation not on record | 8 |
| Tampa, US | 8 |
| San Diego, US | 7 |
| Santa Barbara, US | 7 |
| Fayetteville, US | 7 |
| Valdosta State Universitylocation not on record | 7 |
| Millersville, US | 7 |
| Angwin, US | 7 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 7 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 7 |
| San Francisco de Campeche, MX | 7 |
| AUAlocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 6 |
| MEXUlocation not on record | 6 |
| Torreón, MX | 6 |
| Staten Island, US | 6 |
| The University of Arizonalocation not on record | 6 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 6 |
| Montréal, CA | 6 |
| CASlocation not on record | 6 |
| Texas A&M Universitylocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Henderson, US | 5 |
| Provo, US | 5 |
| Burlington, US | 5 |
| US | 5 |
| Mérida, MX | 4 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| Irvine, US | 4 |
| Hermosillo, MX | 4 |
| Fredericksburg, US | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Stephenville, US | 4 |
| Ciudad de México, MX | 3 |
| Dover, US | 3 |
| University of New Hampshirelocation not on record | 3 |
| Columbus State Universitylocation not on record | 3 |
| VENlocation not on record | 3 |
| Arcata, US | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Odawara, JP | 3 |
| Mississippi State, US | 3 |
| Norfolk, US | 3 |
| Chapingo, MX | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Stockholm, SE | 2 |
| Little Rock, US | 2 |
| Knoxville, US | 2 |
| Puebla, MX | 2 |
| Albuquerque, US | 2 |
| Denver, US | 2 |
| Lubbock, US | 2 |
| Edinburgh, GB | 2 |
| New Brunswick, US | 2 |
| Salvador, BR | 2 |
| Fairfax, US | 2 |
| Chadron, US | 2 |
| Dekalb, US | 2 |
| Asheville, US | 2 |
| Tempe, US | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Zacatecas, MX | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Tsukuba, JP | 1 |
| León, NI | 1 |
| GB | 1 |
| Kingston, US | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
| Long Beach, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Taipei, TW | 1 |
| US | 1 |
| Wellington, NZ | 1 |
| Ciudad de México, MX | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| US | 1 |
| San Isidro, AR | 1 |
| Ensenada, MX | 1 |
| Los Angeles, US | 1 |
| Autlán de Navarro, MX | 1 |
| Mexico City, MX | 1 |
| Mexico City, MX | 1 |
| San Francisco, US | 1 |
| UNICAMPlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Vancouver, CA | 1 |
| Oskarshamn, SE | 1 |
| Moscow State Universitylocation not on record | 1 |
| MSB-2797location not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Macomb, US | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Chicago, US | 1 |
| USONlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| Wlocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Juriquilla, MX | 1 |
| Podgorica, ME | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
158 institutions · 2 083 of 2 136 vouchered records shown · 53 without an institution code
09Environmental DNA5 detections
Where the DNA of Andropogon glomeratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.8 °C 17.7–18.2
Seasonal swing summer↔winter20.6 °C
Max temp (day)24.1 °C 23.9–24.5
Min temp (night)13.5 °C 13.4–14.1
Precipitation104 mm/mo 101–105
Air humidity56.2 % 56.1–57.3
Moisture balance17.5 mm/mo -4.00–18.0
Vapour deficit891 Pa 882–892
Wind speed2.60 m/s 2.20–3.40
Cloud cover35.5 % 34.3–35.5
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.