Androniscus roseus

(C.Koch, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Isopoda/Trichoniscidae/Androniscus

At a glance

Occurrence records84

Data sources6

Biological traits0

DNA specimens10

eDNA detections3

Sources6 archives

Databases and archives Androniscus roseus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD10 specimens

01Narrative

Zeichnung von Androniscus roseus Androniscus roseus ist eine in Mitteleuropa verbreitete Art der zu den Landasseln gehörenden Zwergasseln.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Androniscus roseus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes2

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

88Cmostly conserved

649Avariable

TACTCTTTATTTTATTTTTGGGGCTTGAGCAGGCGCTGTTGGAACAGCGCTAAGTGTAATTATCCGGACAGAGTTAGGACACCCGGGCGG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type84 records

Wild obs. + sensor44

Museum / vouchered34

Other6

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 10≤1 km 3≤10 km 15>10 km 8

36 georeferenced · 8 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	25
Washington, US	3
Brussels, BE	2
Croatian Biospeleological Societylocation not on record	2

4 institutions · 32 of 34 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Androniscus roseus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 5.90–8.80

Seasonal swing summer↔winter19.4 °C

Max temp (day)12.2 °C 11.0–13.4

Min temp (night)2.10 °C 1.20–3.00

Precipitation104 mm/mo 92.8–115

Air humidity59.1 % 58.6–59.7

Moisture balance40.5 mm/mo 13.6–67.3

Vapour deficit426 Pa 380–473

Wind speed3.10 m/s 2.90–3.40

Cloud cover42.8 % 40.5–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)