Androlepis skinneri

(K.Koch) Brongn. ex Houllet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Androlepis

At a glance

Occurrence records243

Data sources6

Biological traits9

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Androlepis skinneri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Androlepis skinneri est une espèce de plante de la famille des Bromeliaceae, originaire du Costa Rica, du Honduras et du Guatemala.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTforest

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Androlepis skinneri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOL536744.1 ↗553 bpUSA · 2019

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGC …

Androlepis skinneri voucher MO:Carlsen3517 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type243 records

Wild obs. + sensor62

Museum / vouchered181

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 22≤1 km 10≤10 km 4>10 km 3

39 georeferenced · 23 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 85≤1 km 1≤10 km 1

87 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	36
Durango, MX	34
Saint Louis, US	27
Ciudad de México, MX	19
Chicago, US	13
Tampa, US	7
University of Stellenboschlocation not on record	7
Bronx, US	5
Mérida, MX	5
Museo Nacional de Costa Rica (MNCR)location not on record	4
Madison, US	4
South Kensington, GB	3
Tapachula, MX	2
National Biodiversity Institute, Costa Ricalocation not on record	2
MEXUlocation not on record	2
Chapingo, MX	1
Durham, US	1
Universidad Juárez Autónoma de Tabascolocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Porto Alegre, BR	1
Antiguo Cuscatlán, SV	1
San José, CR	1

22 institutions · 177 of 181 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Androlepis skinneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 18.8–18.8

Seasonal swing summer↔winter26.3 °C

Max temp (day)24.2 °C

Min temp (night)14.1 °C

Precipitation140 mm/mo

Air humidity56.6 %

Moisture balance-7.70 mm/mo

Vapour deficit940 Pa

Wind speed3.40 m/s

Cloud cover41.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)