Androlaelaps casalis

(A.Berlese, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Mesostigmata/Laelapidae/Androlaelaps

At a glance

Occurrence records2 460

Data sources9

Biological traits0

DNA specimens23

eDNA detections19

Sources9 archives

Databases and archives Androlaelaps casalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 460 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 460 records

Environmental DNA1 datasets · 3 countries19 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · TreeOfSex2n = 14

01Narrative

Androlaelaps casalis formerly known as Haemolaelaps casalis is a species of predatory mite that feeds on other mites and small invertebrates. It cannot bite or sting birds and humans because its mandibles are not designed for sucking but for predation on other mites. Because Androlaelaps casalis mites feed off parasitic mites like Dermanyssus gallinae, individuals with red colored abdomens can be found. This is not due to any blood-sucking by A. casalis but is because it has ingested blood-engorged parasitic mites. There is some evidence that it may be associated with dermatitis in humans.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Androlaelaps casalis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs3

Marker genes1

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

190Gvariable

AACTCTTTATTTAATTTTTTCTTTATGAGCAGGATTTGTAGGTACATCATTAAGTATATTAATTCGTATTGAATTAGGTCAACCTGGTTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Androlaelaps casalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Norton, R. A., J. B. Kethley, D. E. Johnston, and B. M. O'Connor. 1993. Phylogenetic perspectives on genetic systems and reproductive modes of mites. Pp. 8-99 in D. L. Wrensch and M. A. Ebbert, Evolution and diversity of sex ratio in insects and mites, Springer. ↗

08Occurrence & distribution

Record type2 460 records

Wild obs. + sensor4

Museum / vouchered2 456

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤1 km 32≤10 km 6>10 km 19

57 georeferenced · 2 399 without coordinates

Open the institutions mapphysical evidence2 456

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adam Mickiewicz University in Poznańlocation not on record	2 237
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	82
Helsinki, FI	21
Natick, US	14
University of Tokyo, Department of Zoologylocation not on record	14
Harold Winfred Manter Laboratory of Parasitologylocation not on record	11
Universite Montpellier 3location not on record	5
ZMB/Chellocation not on record	4
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	3
MZLUlocation not on record	2
Hebrew University of Jerusalem, National Collections of Natural Historylocation not on record	1
Tartu, EE	1
Royal Museum for Central Africalocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

14 institutions · 2 397 of 2 456 vouchered records shown · 59 without an institution code

09Environmental DNA19 detections

Where the DNA of Androlaelaps casalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

manure from a barn commercial layer farmPoultry housesoil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.10 °C 4.20–13.9

Seasonal swing summer↔winter18.2 °C

Max temp (day)9.90 °C 6.60–18.0

Min temp (night)3.70 °C 0.8–9.70

Precipitation95.6 mm/mo 75.1–166

Air humidity65.1 % 56.6–66.3

Moisture balance54.2 mm/mo 28.2–82.8

Vapour deficit346 Pa 279–662

Wind speed3.60 m/s 2.60–3.80

Cloud cover51.5 % 34.1–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Androlaelaps casalis

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 460 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 460 records