Andrena ventricosa

Dours, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records161

Data sources6

Biological traits1

DNA specimens21

eDNA detections6

Sources6 archives

Databases and archives Andrena ventricosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF161 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD21 specimens

01Narrative

Andrena ventricosa is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1873 door Dours.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.63 mm

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena ventricosa has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes2

eDNA detections6

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

19Tvariable

22Tvariable

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

46Cmostly conserved

88Tmostly conserved

97Tvariable

136Tmostly conserved

157Tmostly conserved

190Gvariable

235Tmostly conserved

250Tmostly conserved

340Tvariable

376Avariable

400Amostly conserved

406Cmostly conserved

427Tvariable

457Cmostly conserved

463Cvariable

472Tmostly conserved

473Tmostly conserved

499Cmostly conserved

505Tmostly conserved

523Tmostly conserved

536Tvariable

538Amostly conserved

544Tvariable

550Amostly conserved

553Gvariable

571Tmostly conserved

574Tvariable

601Cmostly conserved

619Tmostly conserved

631Gmostly conserved

640Cvariable

658Tmostly conserved

TATACTTTACTTCATTTTTGCTATATGAGCAGGAATAATTGGAGCCTCCCTAAGATTTATAATCCGAATAGAACTAAGAAATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes9

BINs3

Most divergent pair3.3%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena brumanensissame genus10.6%Andrena impressasame genus14.4%Andrena sphecodimorphasame genus14.4%Andrena labiatasame genus14.6%Andrena politasame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type161 records

Wild obs. + sensor27

Museum / vouchered120

Other14

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy10% within 1 km

≤100 m 2≤10 km 19

21 georeferenced · 6 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 4≤10 km 10

15 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	9
Wuzhou, CN	3
MNHWlocation not on record	2
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	2
Zürich, CH	2
UMONSlocation not on record	1
Private Collection of Thomas J. Woodlocation not on record	1

7 institutions · 20 of 120 vouchered records shown · 100 without an institution code

09Environmental DNA6 detections

Where the DNA of Andrena ventricosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 10.6–20.5

Seasonal swing summer↔winter15.8 °C

Max temp (day)18.1 °C 14.4–26.0

Min temp (night)10.4 °C 6.10–14.5

Precipitation72.1 mm/mo 26.4–157

Air humidity58.9 % 54.2–60.9

Moisture balance-48.5 mm/mo -124–70.2

Vapour deficit690 Pa 524–1,059

Wind speed3.50 m/s 2.40–3.90

Cloud cover35.7 % 28.9–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)