Andrena symphyti

Schmiedeknecht, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records301

Data sources6

Biological traits0

DNA specimens11

eDNA detections11

Sources6 archives

Databases and archives Andrena symphyti's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility301 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF301 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Andrena symphyti is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1883 door Schmiedeknecht.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena symphyti has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections11

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.8%

Haplotypes2

BINs3

Most divergent pair2.6%

Where individuals differ — all 25 variable positions, in barcode order

61Tvariable

91Tvariable

94Avariable

97Tvariable

109Gvariable

115Cvariable

212Cvariable

259Tvariable

268Avariable

301Avariable

358Cmostly conserved

364Tvariable

385Tmostly conserved

400Cvariable

406Cvariable

415Tmostly conserved

433Tvariable

439Cvariable

457Tvariable

463Tvariable

475Tvariable

514Avariable

550Avariable

631Avariable

646Tvariable

AATATTATATTTTATCTTCGCTATATGAGCAGGAATAATTGGTGCATCACTTAGATTCATTATTCGTATAGAATTAAGAAATCCAGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena bicolorsame genus7.9%Andrena montanasame genus8.2%Andrena impressasame genus8.3%Andrena glidiasame genus8.4%Andrena granulosasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type301 records

Wild obs. + sensor38

Museum / vouchered256

Other7

Origin

Native20

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 9≤1 km 17≤10 km 7

33 georeferenced · 5 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤1 km 172≤10 km 55

227 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence256

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	176
ZMHB, ES, NHMUK, OLML, SMNHTAU, TJWlocation not on record	11
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
ZSMlocation not on record	5
Wuzhou, CN	4
Bavarian State Collection of Zoologylocation not on record	4
PRAZlocation not on record	2
Zürich, CH	2
Bonn, DE	2
NMOKlocation not on record	2
Champaign, US	2
MNHWlocation not on record	1
Philadelphia, US	1
	1
MSVIlocation not on record	1

16 institutions · 230 of 256 vouchered records shown · 26 without an institution code

09Environmental DNA11 detections

Where the DNA of Andrena symphyti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

Mediterranean scrub

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 9.30–15.3

Seasonal swing summer↔winter19.2 °C

Max temp (day)18.6 °C 13.6–19.7

Min temp (night)9.10 °C 3.80–10.5

Precipitation62.6 mm/mo 47.4–113

Air humidity57.8 % 56.6–58.4

Moisture balance-39.6 mm/mo -52.7–5.30

Vapour deficit690 Pa 503–781

Wind speed3.00 m/s 1.90–3.50

Cloud cover33.3 % 30.8–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)