Andrena schencki

Morawitz, 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records645

Data sources6

Biological traits1

DNA specimens13

eDNA detections5

Sources6 archives

Databases and archives Andrena schencki's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility645 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF645 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD13 specimens

01Narrative

De rode zandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1866 door Morawitz.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)2.4 mm

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena schencki has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections5

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

1Avariable

2Cvariable

19Amostly conserved

35Amostly conserved

43Cvariable

55Tmostly conserved

115Tmostly conserved

136Cmostly conserved

216Tmostly conserved

260Cmostly conserved

287Cmostly conserved

316Cmostly conserved

379Tmostly conserved

382Cmostly conserved

406Cmostly conserved

454Tmostly conserved

502Tmostly conserved

520Cmostly conserved

532Tmostly conserved

568Tmostly conserved

613Cmostly conserved

634Tmostly conserved

643Tmostly conserved

ACTATATTTCATCTTCGCAATATGAGCTGGAATAATTGGAGCCTCATTAAGATTTATTATTCGTATAGAACTAAGAAATCCAGGAAACTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BINs2

Most divergent pair3.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena cressoniisame genus10.0%Andrena wataseisame genus10.4%Andrena parathoracicasame genus11.3%Andrena gelriaesame genus11.8%Andrena griseobalteatasame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type645 records

Wild obs. + sensor116

Museum / vouchered492

Other37

Origin

Native111

Range

Area of Occupancy AOO1 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 16≤1 km 15≤10 km 66

97 georeferenced · 19 without coordinates

Open the mapobservation + sensor116

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 8≤1 km 74≤10 km 334>10 km 18

434 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence492

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ULglocation not on record	104
Provincia di Livornolocation not on record	83
Paro, BT	30
Frauenfeld, CH	24
Musee d'Histoire Naturallelocation not on record	24
Muzeum Górnośląskie w Bytomiulocation not on record	18
NMOKlocation not on record	17
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Bern, CH	15
PRAZlocation not on record	14
Zürich, CH	11
Wuzhou, CN	9
Bonn, DE	8
Mons, BE	7
Fribourg, CH	6
Geneva, CH	6
	6
Philadelphia, US	4
PRUNlocation not on record	4
Natuurpuntlocation not on record	3
Sion, CH	2
University of Florence, Department of Biologylocation not on record	2
IZNElocation not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Museum zu Allerheiligen Schaffhausenlocation not on record	2
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
KZMlocation not on record	1
Universität Zürich, Naturhistorisches Museumlocation not on record	1
MNHWlocation not on record	1
MSlocation not on record	1
UMUlocation not on record	1

32 institutions · 427 of 492 vouchered records shown · 65 without an institution code

09Environmental DNA5 detections

Where the DNA of Andrena schencki was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 16.1–20.6

Seasonal swing summer↔winter16.7 °C

Max temp (day)25.2 °C 21.8–27.3

Min temp (night)11.9 °C 9.80–13.7

Precipitation10.2 mm/mo 8.90–43.9

Air humidity53.5 % 53.3–56.8

Moisture balance-145 mm/mo -154–-97.6

Vapour deficit1,011 Pa 806–1,143

Wind speed3.10 m/s 2.30–3.10

Cloud cover22.9 % 22.7–34.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)