Andrena rufula

Schmiedeknecht, 1883 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records273

Data sources6

Biological traits1

DNA specimens15

eDNA detections18

Sources6 archives

Databases and archives Andrena rufula's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF273 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD15 specimens

01Narrative

Andrena rufula is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1883 door Schmiedeknecht.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.13 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena rufula has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections18

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.91%

Haplotypes1

BIN1

Where individuals differ — all 17 variable positions, in barcode order

43Amostly conserved

157Tmostly conserved

178Tmostly conserved

184Amostly conserved

217Amostly conserved

226Cmostly conserved

244Gmostly conserved

322Amostly conserved

331Amostly conserved

340Tmostly conserved

359Gmostly conserved

433Amostly conserved

511Amostly conserved

577Gmostly conserved

578Tmostly conserved

616Cmostly conserved

631Gmostly conserved

GATATTATACTTTATCTTCGCTATATGAGCAGGAATAATTGGAGCATCACTTAGATTTATTATTCGTATAGAATTAAGAAATCCAGGTAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena chrysopussame genus8.7%Andrena igraecasame genus9.0%Andrena rufitibialissame genus9.1%Andrena glidiasame genus9.1%Andrena montanasame genus9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type273 records

Wild obs. + sensor75

Museum / vouchered197

Other1

Origin

Native18

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 9≤1 km 4≤10 km 23>10 km 1

37 georeferenced · 38 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 6≤1 km 22≤10 km 38>10 km 1

67 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	17
Musee d'Histoire Naturallelocation not on record	8
PRUNlocation not on record	6
PRAZlocation not on record	4
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	4
Zürich, CH	4
	2
Mons, BE	2
MNHWlocation not on record	1
ZSMlocation not on record	1
University of Florence, Department of Biologylocation not on record	1
NMOKlocation not on record	1
XIIlocation not on record	1

13 institutions · 52 of 197 vouchered records shown · 145 without an institution code

09Environmental DNA18 detections

Where the DNA of Andrena rufula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 5.70–11.3

Seasonal swing summer↔winter15.5 °C

Max temp (day)13.9 °C 8.80–15.9

Min temp (night)4.30 °C 2.70–6.20

Precipitation85.0 mm/mo 50.8–89.0

Air humidity59.9 % 56.8–66.2

Moisture balance0.9 mm/mo -36.4–51.8

Vapour deficit506 Pa 310–587

Wind speed4.10 m/s 3.50–4.50

Cloud cover42.8 % 39.1–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)