Andrena humilis
Imhoff, 1832 · speciesAt a glance
Occurrence records10 600
Data sources7
Biological traits1
DNA specimens41
eDNA detections24
Sources7 archives
Databases and archives Andrena humilis's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 600 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics41 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources1 traits
Occurrence & distributionGBIF10 600 records
Environmental DNA1 datasets · 8 countries24 detections
DNA & barcodingBOLD41 specimens
01Narrative
Andrena humilis is a Palearctic species of mining bee.BWARSEdward Saunders 1896, The Hymenoptera Aculeata of the British Isles London. pdf us.archive Full text with illustrations]
No narrative description available for this taxon yet.
02Traits & measurements
SourcesBeeMorph
Size & morphology1
Intertegular distance (ITD)2.44 mm
05DNA & barcoding41 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena humilis has left across the world's sequence archives.
At a glance
DNA specimens41
BINs9
Marker genes2
eDNA detections24
Countries11
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P651 bp consensus25 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.
Where individuals differ — all 133 variable positions, in barcode order
2Cmostly conserved
7Tmostly conserved
16Tmostly conserved
19Amostly conserved
26Tvariable
31Tmostly conserved
35Amostly conserved
37Cvariable
40Amostly conserved
43Cmostly conserved
46Amostly conserved
47Tmostly conserved
61Tmostly conserved
64Amostly conserved
71Tmostly conserved
84Amostly conserved
85Tmostly conserved
94Tvariable
112Cvariable
115Cmostly conserved
121Tvariable
127Avariable
130Tmostly conserved
136Tmostly conserved
142Tmostly conserved
148Tmostly conserved
151Cmostly conserved
154Tvariable
160Cvariable
169Tmostly conserved
175Tmostly conserved
181Avariable
187Amostly conserved
196Cvariable
202Amostly conserved
203Cmostly conserved
209Cmostly conserved
211Cvariable
214Avariable
217Amostly conserved
220Tmostly conserved
229Cmostly conserved
244Tmostly conserved
247Tmostly conserved
256Tmostly conserved
260Tmostly conserved
265Cmostly conserved
268Cvariable
278Cmostly conserved
281Avariable
287Tmostly conserved
297Tmostly conserved
299Avariable
301Tvariable
302Cmostly conserved
307Tmostly conserved
313Gvariable
316Cmostly conserved
319Amostly conserved
325Amostly conserved
334Amostly conserved
340Cmostly conserved
344Cvariable
346Gmostly conserved
349Amostly conserved
352Tmostly conserved
355Cmostly conserved
356Gmostly conserved
360Tmostly conserved
361Cmostly conserved
364Tvariable
373Cvariable
376Tvariable
382Cmostly conserved
383Cmostly conserved
385Cmostly conserved
394Cmostly conserved
397Amostly conserved
400Amostly conserved
403Tmostly conserved
406Cmostly conserved
409Amostly conserved
412Amostly conserved
413Gmostly conserved
415Avariable
418Amostly conserved
430Tmostly conserved
433Tmostly conserved
439Tmostly conserved
442Cvariable
445Cmostly conserved
448Cvariable
454Cvariable
460Tmostly conserved
469Tmostly conserved
472Cmostly conserved
481Cmostly conserved
496Cmostly conserved
499Tmostly conserved
502Cvariable
505Amostly conserved
517Tmostly conserved
520Cmostly conserved
529Tvariable
532Amostly conserved
536Tvariable
541Cmostly conserved
547Gmostly conserved
550Cvariable
553Cmostly conserved
554Tmostly conserved
559Amostly conserved
562Avariable
565Amostly conserved
568Tmostly conserved
577Cmostly conserved
580Cmostly conserved
583Tmostly conserved
586Tvariable
592Tmostly conserved
+13 more variable positions not shown
ACTATATTTCATTTTTGCAATATGATCAGGTATAATCGGAGCCTCATTAAGATTTATTATTCGAATAGAATTAAGAAATCCAGATAAATG …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)7.5%
Haplotypes9
BINs9
Most divergent pair19.8%
Europe
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P16S
animal barcoderibosomal
08Occurrence & distribution
Record type10 600 records
Wild obs. + sensor4 075
Museum / vouchered6 129
Other396
Origin
Native3 176
Range
Area of Occupancy AOO7 956 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy19% within 1 km
≤100 m 549≤1 km 189≤10 km 3 200>10 km 3
3 941 georeferenced · 134 without coordinates
Open the mapobservation + sensor4 075
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy10% within 1 km
≤100 m 135≤1 km 472≤10 km 5 087>10 km 150
5 844 georeferenced · 285 without coordinates
Open the institutions mapphysical evidence6 129
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions25 of 66 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Zürich, CH | 1 027 |
| Bern, CH | 523 |
| Musee d'Histoire Naturallelocation not on record | 487 |
| ULglocation not on record | 378 |
| Provincia di Livornolocation not on record | 306 |
| Paro, BT | 222 |
| Dhaka, BD | 188 |
| Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record | 130 |
| PRAZlocation not on record | 115 |
| MZLUlocation not on record | 110 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 83 |
| SLU Artdatabankenlocation not on record | 76 |
| Natural History Museum Rotterdamlocation not on record | 72 |
| Muzeum Górnośląskie w Bytomiulocation not on record | 67 |
| Museum zu Allerheiligen Schaffhausenlocation not on record | 64 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 60 |
| Helsinki, FI | 52 |
| ARTlocation not on record | 51 |
| Coimbra, PT | 46 |
| Forschungsinstitut für biologischen Landbau Frick | Research Institute of Organic Agriculture Fricklocation not on record | 45 |
| Mons, BE | 44 |
| KZMlocation not on record | 34 |
| Bonn, DE | 31 |
| Natuurpuntlocation not on record | 31 |
| NMOKlocation not on record | 30 |
| Cambridge, US | 22 |
| Geneva, CH | 18 |
| Wuzhou, CN | 18 |
| Frauenfeld, CH | 18 |
| John May Museum of Natural Historylocation not on record | 17 |
| IENElocation not on record | 16 |
| Philadelphia, US | 15 |
| Sion, CH | 12 |
| PRUNlocation not on record | 9 |
| ZSMlocation not on record | 8 |
| CBDClocation not on record | 7 |
| 7 | |
| Champaign, US | 6 |
| NCMGlocation not on record | 6 |
| MNHWlocation not on record | 6 |
| UMONSlocation not on record | 5 |
| Nijmegen, NL | 5 |
| Universität Zürich, Naturhistorisches Museumlocation not on record | 5 |
| Gothenburg, SE | 4 |
| Tallinn, EE | 4 |
| US | 3 |
| ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record | 3 |
| Naturmuseum Solothurnlocation not on record | 2 |
| EIBElocation not on record | 2 |
| Haus der Natur, Salzburglocation not on record | 2 |
| Winterthur, CH | 2 |
| Tromsø, NO | 1 |
| Bavarian State Collection of Zoologylocation not on record | 1 |
| Museu Nacional de História Natural e da Ciêncialocation not on record | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| UGRlocation not on record | 1 |
| Research Collection of Christophe Prazlocation not on record | 1 |
| Ghent, BE | 1 |
| Tilburg, NL | 1 |
| University of Florence, Department of Biologylocation not on record | 1 |
| IMEDEAlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record | 1 |
| South Kensington, GB | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
66 institutions · 4 509 of 6 129 vouchered records shown · 1 620 without an institution code
09Environmental DNA24 detections
Where the DNA of Andrena humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map8 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 9.60–18.4
Seasonal swing summer↔winter18.8 °C
Max temp (day)18.1 °C 13.8–22.6
Min temp (night)8.90 °C 4.10–13.4
Precipitation83.4 mm/mo 63.6–158
Air humidity59.1 % 58.1–60.5
Moisture balance-35.2 mm/mo -75.7–29.2
Vapour deficit676 Pa 500–859
Wind speed3.20 m/s 2.60–4.20
Cloud cover38.4 % 32.7–44.9
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.