Andrena distinguenda

Schenck, 1871 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records468

Data sources6

Biological traits1

DNA specimens62

eDNA detections51

Sources6 archives

Databases and archives Andrena distinguenda's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility468 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics62 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF468 records

Environmental DNA1 datasets · 3 countries51 detections

DNA & barcodingBOLD62 specimens

01Narrative

De kruisbloemzandbij is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1871 door Schenck.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.68 mm

05DNA & barcoding62 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena distinguenda has left across the world's sequence archives.

At a glance

DNA specimens62

BINs3

Marker genes2

eDNA detections51

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

134Cmostly conserved

137Amostly conserved

365Tmostly conserved

386Gmostly conserved

530Tmostly conserved

593Tmostly conserved

644Cmostly conserved

TACTATACTTTATTTTCGCTATATGAGCCGGAATAATTGGAGCATCATTAAGATTCATCATTCGTATAGAACTAAGCAATCCAGGCAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes4

BINs3

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena nitidulasame genus7.0%Andrena clarkellasame genus12.0%Andrena fulvasame genus12.1%Andrena rogenhoferisame genus12.2%Andrena urdulasame genus12.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type468 records

Wild obs. + sensor351

Museum / vouchered111

Other6

Origin

Native15

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 9≤1 km 3≤10 km 20

32 georeferenced · 319 without coordinates

Open the mapobservation + sensor351

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 14≤10 km 47

61 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	15
Zürich, CH	13
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	10
Provincia di Livornolocation not on record	8
ZSMlocation not on record	7
Bavarian State Collection of Zoologylocation not on record	5
NMOKlocation not on record	4
Geneva, CH	3
ENSAT - L'Ecole Nationale Superieure Agronomique de Toulouselocation not on record	2
Philadelphia, US	2
Bonn, DE	2
MNHWlocation not on record	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Private Collection of Marco Bonifacinolocation not on record	1
Tilburg, NL	1

15 institutions · 75 of 111 vouchered records shown · 36 without an institution code

09Environmental DNA51 detections

Where the DNA of Andrena distinguenda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.20–10.7

Seasonal swing summer↔winter14.7 °C

Max temp (day)8.70 °C 8.20–14.8

Min temp (night)2.70 °C 2.50–5.30

Precipitation85.0 mm/mo 79.1–93.5

Air humidity66.2 % 59.8–67.2

Moisture balance52.1 mm/mo -17.1–62.8

Vapour deficit310 Pa 292–537

Wind speed4.50 m/s 4.10–4.60

Cloud cover50.7 % 42.8–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)