Andrena decipiens

Schenck, 1861 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records262

Data sources6

Biological traits2

DNA specimens23

eDNA detections7

Sources6 archives

Databases and archives Andrena decipiens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF262 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD23 specimens

01Narrative

Andrena decipiens is een vliesvleugelig insect uit de familie Andrenidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1861 door Schenck.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Body length1.25 cm

Intertegular distance (ITD)1.61 mm

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena decipiens has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes2

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)4.0%

Haplotypes2

BINs2

Most divergent pair15.7%

Where individuals differ — all 103 variable positions, in barcode order

1Amostly conserved

10Cmostly conserved

13Tmostly conserved

16Tmostly conserved

19Tmostly conserved

22Tmostly conserved

34Amostly conserved

40Amostly conserved

46Cmostly conserved

49Cmostly conserved

50Cmostly conserved

67Amostly conserved

82Tmostly conserved

91Amostly conserved

97Cmostly conserved

100Cmostly conserved

115Tmostly conserved

121Amostly conserved

122Gmostly conserved

127Amostly conserved

133Amostly conserved

139Tmostly conserved

145Tmostly conserved

154Tmostly conserved

163Gmostly conserved

232Tmostly conserved

247Tmostly conserved

256Tmostly conserved

271Tmostly conserved

274Cmostly conserved

277Gmostly conserved

280Tmostly conserved

281Amostly conserved

283Cmostly conserved

286Cmostly conserved

287Amostly conserved

289Cmostly conserved

290Amostly conserved

293Tmostly conserved

298Tmostly conserved

300Tmostly conserved

305Tmostly conserved

316Cmostly conserved

319Amostly conserved

325Tmostly conserved

334Amostly conserved

337Tmostly conserved

340Cmostly conserved

343Cmostly conserved

346Tmostly conserved

349Tmostly conserved

357Amostly conserved

359Amostly conserved

361Cmostly conserved

367Cmostly conserved

373Tmostly conserved

376Cmostly conserved

397Cmostly conserved

400Cmostly conserved

406Cmostly conserved

416Amostly conserved

418Cmostly conserved

433Tmostly conserved

457Tmostly conserved

460Tmostly conserved

475Cmostly conserved

478Cmostly conserved

484Cmostly conserved

490Tmostly conserved

499Cmostly conserved

500Tmostly conserved

505Tmostly conserved

514Amostly conserved

520Cmostly conserved

523Cmostly conserved

529Amostly conserved

532Tmostly conserved

535Amostly conserved

536Cmostly conserved

538Tmostly conserved

547Cmostly conserved

548Cmostly conserved

553Amostly conserved

557Cmostly conserved

559Amostly conserved

562Tmostly conserved

568Cmostly conserved

571Cmostly conserved

574Tmostly conserved

578Tmostly conserved

595Tmostly conserved

601Cmostly conserved

604Cmostly conserved

613Cmostly conserved

616Cmostly conserved

631Amostly conserved

634Cmostly conserved

637Cmostly conserved

641Tmostly conserved

643Amostly conserved

646Cmostly conserved

652Cmostly conserved

658Cmostly conserved

AATACTATACTTTATTTTTGCTATATGAGCAGGAATAATAGGAGCCTCCCTAAGATTCATTATTCGAATAGAATTAAGAAATCCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena flavilabrissame genus2.3%Andrena labialissame genus7.3%Andrena variabilissame genus8.5%Andrena cyanophilasame genus12.2%Andrena mehelyisame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type262 records

Wild obs. + sensor132

Museum / vouchered118

Other12

Origin

Native1

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 9≤1 km 14≤10 km 22

45 georeferenced · 87 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤1 km 16≤10 km 23>10 km 2

41 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	14
ZSMlocation not on record	10
Bavarian State Collection of Zoologylocation not on record	10
Wuzhou, CN	6
NMOKlocation not on record	6
Provincia di Livornolocation not on record	4
Bonn, DE	4
Geneva, CH	3
Philadelphia, US	2
	2
Dhaka, BD	2
University of Florence, Department of Biologylocation not on record	1
OOLMlocation not on record	1
Uniwersytet Łódzkilocation not on record	1
McWane Science Centerlocation not on record	1

15 institutions · 67 of 118 vouchered records shown · 51 without an institution code

09Environmental DNA7 detections

Where the DNA of Andrena decipiens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 17.7–18.6

Seasonal swing summer↔winter18.6 °C

Max temp (day)22.7 °C 22.2–22.9

Min temp (night)13.7 °C 12.1–13.9

Precipitation72.0 mm/mo 58.7–79.7

Air humidity58.1 % 56.3–58.3

Moisture balance-59.0 mm/mo -64.2–-58.0

Vapour deficit897 Pa 870–899

Wind speed3.40 m/s 3.20–3.60

Cloud cover35.3 % 33.7–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)