Andrena angustitarsata

Viereck, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Andrenidae/Andrena

At a glance

Occurrence records2 905

Data sources7

Biological traits1

DNA specimens40

eDNA detections65

Sources7 archives

Databases and archives Andrena angustitarsata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 905 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 905 records

Environmental DNA1 datasets · 2 countries65 detections

DNA & barcodingBOLD40 specimens

01Narrative

The narrow-legged miner bee (Andrena angustitarsata) is a species of miner bee in the family Andrenidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.8 mm

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andrena angustitarsata has left across the world's sequence archives.

At a glance

DNA specimens40

BINs2

Marker genes1

eDNA detections65

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

82Cvariable

463Tmostly conserved

493Avariable

499Cmostly conserved

511Avariable

536Cvariable

539Cmostly conserved

544Tvariable

634Cmostly conserved

TATACTATACTTCATCTTCGCCATATGAGCAGGTATAGTAGGAGCCTCATTAAGATTCATCATCCGTATAGAACTAAGAAACCCAGGCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes11

BINs2

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Andrena lepidasame genus9.9%Andrena nasoniisame genus10.0%Andrena yamatosame genus10.0%Andrena mehelyisame genus10.2%Andrena opacifoveasame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 905 records

Wild obs. + sensor3

Museum / vouchered2 371

Other531

Range

Area of Occupancy AOO2 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 36≤1 km 44≤10 km 461>10 km 11

552 georeferenced · 1 819 without coordinates

Open the institutions mapphysical evidence2 371

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	1 121
Champaign, US	407
Wuzhou, CN	283
	159
Weber State University, Bird and Mammal Collectionlocation not on record	99
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	56
Essig Museum of Entomologylocation not on record	39
San Diego, US	38
Roberts Creek, CA	33
WSUClocation not on record	29
Santa Cruz, US	23
BBSLlocation not on record	14
Colorado State Universitylocation not on record	10
OSUClocation not on record	10
Vancouver, CA	9
WIlocation not on record	6
München, DE	4
Awka, NG	4
US	3
Santa Barbara Museum of Natural Historylocation not on record	3
University of Alabamalocation not on record	3
Chicago, US	2
Toronto, CA	2
Cambridge, US	1
Oregon State Arthropod Collectionlocation not on record	1

25 institutions · 2 359 of 2 371 vouchered records shown · 12 without an institution code

09Environmental DNA65 detections

Where the DNA of Andrena angustitarsata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 4.00–18.4

Seasonal swing summer↔winter21.6 °C

Max temp (day)18.0 °C 8.20–26.0

Min temp (night)3.90 °C -1.60–10.6

Precipitation29.8 mm/mo 14.3–74.4

Air humidity52.1 % 43.9–56.8

Moisture balance-92.2 mm/mo -161–-38.6

Vapour deficit666 Pa 377–1,160

Wind speed2.90 m/s 1.90–4.40

Cloud cover37.7 % 24.9–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Andrena angustitarsata

At a glance

Sources7 archives

Size & morphology1

At a glance

Record type2 905 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 905 records