Andira inermis
(W.Wright) DC. · speciesAt a glance
Occurrence records2 930
Data sources12
Biological traits117
DNA specimens27
eDNA detections26
Sources12 archives
Databases and archives Andira inermis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 930 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources117 traits
Chemical compositionLOTUS · NPASS39 compounds
Occurrence & distributionGBIF2 930 records
Environmental DNA2 datasets · 8 countries26 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Andira inermis est une espèce de plantes à fleurs de la famille des Fabaceae. C'est un arbre tropical d'Amérique. Andira inermis subsp. inermis aussi connue sous la dénomination botanique Geoffroea inermis W. Wright est une plante à fruits comestibles.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology7
Leaf size2 793 mm²
Plant height19.87 m
⚠ sources differ — GIFT: 19.87 m · USDA: 27.43 m · TRY: 26.96 m
Plant height max35 m
Plant height min6.1 m
Seed length max30 mm
Seed length min15 mm
Seed mass848 mg
⚠ sources differ — TRY: 848 mg · GIFT: 2 387 mg
Life cycle & reproduction28
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryLong
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatMedium
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureMedium
Fruit colourbrown
Growth formtree
Growth form USDASingle Stem
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza typenon-ectomycorrhizal
Root depth min36 in
Shape and orientationIrregular
Small grainNo
Woodinesswoody
Physiology & chemistry28
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min365 days
Ldmc max406 mg/g
Ldmc min406 mg/g
Leaf C:N ratio17.18 g/g
Leaf c515 mg/g
Leaf dry-matter content (LDMC)361 mg/g
⚠ sources differ — TRY: 361 mg/g · GIFT: 406 mg/g
Leaf n29.7 mg/g
Leaf p1.28 mg/g
Moisture useLow
Nitrogen fixation levelMedium
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max256 in
Precipitation min98 in
Protein potentialMedium
Salinity toleranceMedium
Shade toleranceHigh
Specific leaf area (SLA)18.41 mm²/mg
⚠ sources differ — TRY: 18.41 mm²/mg · GIFT: 10.99 mm²/mg
Temperature min32 °F
Wood density644 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Fuelwood productMedium
Lumber productYes
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productYes
Pulpwood productYes
Seeds per pound190 per lb
ToxicityModerate
Veneer productYes
Other traits9
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr36.58 m
Planting density max640 per acre
Planting density min320 per acre
Sla max10.99 mm²/mg
Sla min10.99 mm²/mg
03Chemical composition39 compounds
Compounds documented for Andira inermis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Isoflavones17
Dihydroflavonols12
Pterocarpan4
2-arylbenzofurans3
Flavanones2
Documented compounds39 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-taxifolin | present | LOTUS | |
| (-)-Maackiain | present | NPASS | |
| (20R)-20-(hydroxymethyl)-3-methoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13(18),14,16-heptaen-16-ol | present | LOTUS | |
| (20S)-20-(hydroxymethyl)-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13(18),14,16-heptaen-16-ol | present | LOTUS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | NPASS | |
| (2R,3R)-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2R,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (S)-Naringenin | present | NPASS | |
| 3',5,5',7-Tetrahydroxyflavanone | present | NPASS | |
| 3'-Hydroxybiochanin A | present | LOTUS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andira inermis has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTCACAAGCAGTGCAACTCGTGAATTTGTTTATCTACTACGGGGTGGTTTG …
Andira inermis culture STRI:Corteva SJWright MP00018 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★rbcLa★trnL-F★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Andira inermis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Chromosome records20–222n range20median20mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 203×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-indian_vol1 — Atchison, E. 1951
CCDB · book-fedorov — Atchison 1951
CCDB · book-atlas-flowering-plants — Atchison 1951
2n 222×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1
CCDB · book-ipcn73-74 — FRITSCH, R. 1970. Chromosomenzahlen von Pflanzen der Insel Kuba. I. Kulturpflanze 18: 189-197.
CCDB · book-indian_vol1 — Von Reinhard, F. 1970 ; Bawa, K.S. 1973
n 111×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — BAWA, K.S. 1973. Chromosome numbers of tree species of a lowland tropical community. J. Arnold Arbor. 54: 422-434.
08Occurrence & distribution
Record type2 930 records
Wild obs. + sensor1 082
Museum / vouchered1 837
Cultivated / captive2
Other9
Origin
Native78
Range
Area of Occupancy AOO6 568 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 287≤1 km 72≤10 km 32>10 km 71
462 georeferenced · 620 without coordinates
Open the mapobservation + sensor1 082
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy76% within 1 km
≤100 m 227≤1 km 41≤10 km 75>10 km 10
353 georeferenced · 1 484 without coordinates
Open the institutions mapphysical evidence1 837
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions66 of 160 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 450 |
| Durango, MX | 128 |
| Bronx, US | 121 |
| National Biodiversity Institute, Costa Ricalocation not on record | 109 |
| Mexico City, MX | 105 |
| University of Stellenboschlocation not on record | 42 |
| Kew, GB | 39 |
| Universidad de Antioquia (UdeA)location not on record | 33 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 24 |
| Austin, US | 23 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 23 |
| JBRJlocation not on record | 21 |
| San José, CR | 20 |
| LDlocation not on record | 20 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 19 |
| León, NI | 19 |
| Tuxtla Gutiérrez, MX | 18 |
| UFMSlocation not on record | 18 |
| Ann Arbor, US | 17 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 17 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 16 |
| Universidad Nacional de Colombia (UNAL)location not on record | 16 |
| Tampa, US | 14 |
| CASlocation not on record | 13 |
| Chapingo, MX | 13 |
| Yaoundé, CM | 12 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 11 |
| QCNElocation not on record | 11 |
| Chicago, US | 10 |
| Antiguo Cuscatlán, SV | 10 |
| Tapachula, MX | 9 |
| Edinburgh, GB | 9 |
| Mérida, MX | 9 |
| Mexico City, MX | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| UNICAMPlocation not on record | 7 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 7 |
| Santa Cruz de la Sierra, BO | 7 |
| Frankfurt am Main | 7 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 7 |
| Xiamen, CN | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| HNBlocation not on record | 6 |
| CNF-UFHBlocation not on record | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| MEXUlocation not on record | 6 |
| Riverside, US | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| Brasília, BR | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| South Kensington, GB | 5 |
| San Francisco, US | 5 |
| Loja, EC | 5 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 5 |
| Salvador, BR | 4 |
| Mexico City, MX | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| ASUlocation not on record | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 4 |
| Aarhus, DK | 4 |
| Altos de Pipe, VE | 3 |
| Herbario UTCEClocation not on record | 3 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 3 |
| Castelar, AR | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| Museum of Zoologylocation not on record | 3 |
| UEPAlocation not on record | 3 |
| arosemena tola, EC | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Miami, US | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Austin, US | 3 |
| Durham, US | 3 |
| UFRRJlocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| IECOSlocation not on record | 3 |
| Seropédica, BR | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Berlin, DE | 3 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 3 |
| Wlocation not on record | 3 |
| Elocation not on record | 3 |
| UEMAlocation not on record | 3 |
| MeiseBGlocation not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| San Francisco de Campeche, MX | 2 |
| Universidad de Córdoba (UC)location not on record | 2 |
| Instituto Nacional de Biodiversidad del Ecuadorlocation not on record | 2 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 2 |
| Mérida, MX | 2 |
| BMlocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Culiacán, MX | 2 |
| Campo Mourão, BR | 2 |
| EL PASO, US | 2 |
| CJBGlocation not on record | 2 |
| Chaguaramas, TT | 2 |
| IPA/SPlocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Bavarian State Collection of Zoologylocation not on record | 2 |
| Guatemala City, GT | 2 |
| UFBAlocation not on record | 2 |
| TULVlocation not on record | 2 |
| Quito, EC | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Mexico City, MX | 2 |
| Ulocation not on record | 1 |
| HUAlocation not on record | 1 |
| Tempe, US | 1 |
| UFPRlocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Auckland, NZ | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| OTSlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Porto Velho, BR | 1 |
| IAvHlocation not on record | 1 |
| Salamanca, ES | 1 |
| San Isidro, AR | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Uberlândia, BR | 1 |
| EFGlocation not on record | 1 |
| La Paz, BO | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Fundación Estación Biológica Guayacanallocation not on record | 1 |
| Barcelona, ES | 1 |
| Santiago de Cali, CO | 1 |
| Madison, US | 1 |
| Glocation not on record | 1 |
| US | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Plocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Managua, NI | 1 |
| Brasília, BR | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| UFAClocation not on record | 1 |
| WAGlocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| MEDELlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| UnBlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Cambridge, US | 1 |
| HEMlocation not on record | 1 |
| Davis, US | 1 |
| Toronto, CA | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| BISHlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Corrientes, AR | 1 |
160 institutions · 1 746 of 1 837 vouchered records shown · 86 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Andira inermis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys2
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map8 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.5 °C 23.7–25.7
Seasonal swing summer↔winter2.50 °C
Max temp (day)26.4 °C 26.2–29.1
Min temp (night)22.2 °C 21.2–23.1
Precipitation181 mm/mo 130–237
Air humidity70.6 % 65.2–74.2
Moisture balance10.9 mm/mo -49.3–77.4
Vapour deficit849 Pa 753–1,157
Wind speed3.60 m/s 1.10–4.20
Cloud cover25.6 % 25.4–59.2
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.