Andersonia heterophylla

Sond. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Andersonia

At a glance

Occurrence records252

Data sources4

Biological traits25

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Andersonia heterophylla's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility252 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF252 records

DNA & barcodingNCBIsequences

01Narrative

Andersonia heterophylla là một loài thực vật có hoa trong họ Thạch nam. Loài này được Sond. mô tả khoa học đầu tiên năm 1845.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length3.5 mm

Leaf mass per area258 g/m2

Leaf width2.25 mm

Plant height0.45 m

⚠ sources differ — AusTraits: 0.45 m · TRY: 0.4 m

Plant height max0.5 m

Plant height min0.1 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timeynnnyyyyyyyy

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry4

Leaf n9.4 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3.87 mm²/mg

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Andersonia heterophylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM209379.1 ↗328 bpAustralia

ACGT

ATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAAGGCACGTCTGCC …

Andersonia heterophylla 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type252 records

Wild obs. + sensor52

Museum / vouchered200

Origin

Native21

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 35≤1 km 16≤10 km 1

52 georeferenced

Open the mapobservation + sensor52

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 31≤1 km 24≤10 km 90>10 km 4

149 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	117
Canberra, AU	23
Mount Annan, AU	21
Museo Entomologico de Leonlocation not on record	10
Hobart, AU	9
Kew, GB	5
Adelaide, AU	5
BGPAlocation not on record	3
Brisbane, AU	2
Claremont, US	1
Armidale, AU	1
LDlocation not on record	1

12 institutions · 198 of 200 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)