Ancyrosoma leucogrammes

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pentatomidae/Ancyrosoma

At a glance

Occurrence records2 600

Data sources7

Biological traits0

DNA specimens9

eDNA detections10

Sources7 archives

Databases and archives Ancyrosoma leucogrammes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 600 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 600 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD9 specimens

01Narrative

Paarung Die Ankerwanze (Ancyrosoma leucogrammes) ist eine Wanze aus der Familie der Baumwanzen (Pentatomidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancyrosoma leucogrammes has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P551 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

56Avariable

59Amostly conserved

68Avariable

110Avariable

152Tmostly conserved

156Tmostly conserved

159Tmostly conserved

176Cmostly conserved

233Cmostly conserved

239Cmostly conserved

240Cvariable

275Tmostly conserved

303Gmostly conserved

359Gmostly conserved

371Amostly conserved

389Cmostly conserved

401Cmostly conserved

432Tmostly conserved

435Tmostly conserved

452Amostly conserved

465Amostly conserved

474Tmostly conserved

AAATTTATAATGTTATAGTAACAGCACATGCCTTTGTTATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTCGGAAACTGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BINs2

Most divergent pair3.1%

OtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Graphosoma melanoxanthumsame family12.5%Carbula biguttatasame family12.7%Chinavia hilarissame family13.2%Dalpada neoclavatasame family13.2%Thyanta accerrasame family13.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 600 records

Wild obs. + sensor2 518

Museum / vouchered81

Other1

Range

Area of Occupancy AOO7 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 857≤1 km 346≤10 km 419>10 km 124

1 746 georeferenced · 772 without coordinates

Open the mapobservation + sensor2 518

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 9≤1 km 8≤10 km 18>10 km 1

36 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	29
Helsinki, FI	15
MZLUlocation not on record	2
Bonn, DE	2
Nanjing, CN	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

6 institutions · 50 of 81 vouchered records shown · 29 without an institution code

09Environmental DNA10 detections

Where the DNA of Ancyrosoma leucogrammes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Urban pine forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 11.3–23.6

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C 15.1–29.3

Min temp (night)7.30 °C 7.30–17.2

Precipitation76.5 mm/mo 0.6–76.5

Air humidity62.5 % 53.4–62.5

Moisture balance-8.00 mm/mo -152–-8.00

Vapour deficit552 Pa 552–1,369

Wind speed4.60 m/s 3.90–4.70

Cloud cover41.8 % 8.50–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancyrosoma leucogrammes

At a glance

Sources7 archives

At a glance

Record type2 600 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 600 records