Ancyloxypha arene

(Edwards, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Ancyloxypha

At a glance

Occurrence records2 063

Data sources7

Biological traits0

DNA specimens58

eDNA detections73

Sources7 archives

Databases and archives Ancyloxypha arene's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 063 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 063 records

Environmental DNA1 datasets · 3 countries73 detections

DNA & barcodingBOLD58 specimens

01Narrative

Ancyloxypha arene, the tropical least skipper, is a species of grass skipper in the butterfly family Hesperiidae. It is found in Central America and North America. The MONA or Hodges number for Ancyloxypha arene is 4005.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancyloxypha arene has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes1

eDNA detections73

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TTTATATTTTTTATTTGGAATTTGAGCAGGAATATTAGGTACTTCTTTAAGCCTATTAATTCGAACAGAATTAAGTAATCCTGGATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.03%

Haplotypes4

BIN1

Most divergent pair0.31%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atalopedes mesogrammasame family7.8%Thymelicus acteonsame family7.8%Panoquina panoquinsame family8.1%Thymelicus sylvestrissame family8.1%Thymelicus stigmasame family8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 063 records

Wild obs. + sensor880

Museum / vouchered1 183

Range

Area of Occupancy AOO2 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 433≤1 km 159≤10 km 77>10 km 37

706 georeferenced · 174 without coordinates

Open the mapobservation + sensor880

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 144≤1 km 27≤10 km 82>10 km 11

264 georeferenced · 919 without coordinates

Open the institutions mapphysical evidence1 183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	804
FLMNH-UFlocation not on record	96
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	68
Colorado State Universitylocation not on record	41
New Haven, US	23
Mexico City, MX	22
Ciudad de México, MX	15
OSUClocation not on record	14
Washington, US	12
Cambridge, US	10
Essig Museum of Entomologylocation not on record	9
Milwaukee Public Museum (MPM)location not on record	5
Natural History Museum of Utahlocation not on record	4
East Lansing, US	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
National Biodiversity Institute, Costa Ricalocation not on record	3
Universidad del Valle de Guatemalalocation not on record	2
US	2
University of Central Floridalocation not on record	2
Denver, US	1
Morelia, MX	1
St. Paul, US	1
El Colegio de la Frontera Surlocation not on record	1
Chicago, US	1

25 institutions · 1 147 of 1 183 vouchered records shown · 36 without an institution code

09Environmental DNA73 detections

Where the DNA of Ancyloxypha arene was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found73

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 73 detections have coordinates

Open the map3 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…Mixed habitatMexico1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.8 °C 21.2–27.2

Seasonal swing summer↔winter8.20 °C

Max temp (day)29.7 °C 24.9–30.8

Min temp (night)22.9 °C 17.4–23.5

Precipitation182 mm/mo 91.8–332

Air humidity65.2 % 64.1–67.7

Moisture balance20.0 mm/mo -59.2–188

Vapour deficit1,221 Pa 802–1,266

Wind speed1.70 m/s 1.70–2.10

Cloud cover25.1 % 19.5–31.8

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancyloxypha arene

At a glance

Sources7 archives

At a glance

Record type2 063 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 063 records