Ancylosis oblitella

Zeller, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Ancylosis

At a glance

Occurrence records1 330

Data sources6

Biological traits0

DNA specimens22

eDNA detections28

Sources6 archives

Databases and archives Ancylosis oblitella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 330 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 330 records

Environmental DNA1 datasets · 13 countries28 detections

DNA & barcodingBOLD22 specimens

01Narrative

Ancylosis obscurella is een vlinder uit de familie snuitmotten (Pyralidae). De wetenschappelijke naam van deze soort is voor het eerst geldig gepubliceerd in 1989 door Balinsky. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylosis oblitella has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections28

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

508Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCATTAAGTCTTTTAATTCGAGCTGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes4

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylosis undulatellasame genus4.3%Pterothrixidia rufellasame family7.6%Ancylosis rufomixtellasame genus7.9%Ancylosis hellenicasame genus7.9%Ancylosis rhodochrellasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 330 records

Wild obs. + sensor1 248

Museum / vouchered78

Other4

Origin

Native2

Range

Area of Occupancy AOO2 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 131≤1 km 110≤10 km 851>10 km 24

1 116 georeferenced · 132 without coordinates

Open the mapobservation + sensor1 248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 25≤1 km 25≤10 km 4>10 km 2

56 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	39
Nijmegen, NL	10
Provincia di Livornolocation not on record	7
ZAF-UMUlocation not on record	6
Zürich, CH	6
Tartu, EE	2
NHMOlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Salzburg, AT	1

9 institutions · 73 of 78 vouchered records shown · 5 without an institution code

09Environmental DNA28 detections

Where the DNA of Ancylosis oblitella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map13 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 7.90–24.1

Seasonal swing summer↔winter17.6 °C

Max temp (day)21.2 °C 11.8–28.8

Min temp (night)12.8 °C 3.40–18.7

Precipitation48.5 mm/mo 17.5–101

Air humidity56.4 % 46.3–61.5

Moisture balance-78.2 mm/mo -146–5.50

Vapour deficit896 Pa 464–1,499

Wind speed3.40 m/s 2.20–4.40

Cloud cover35.5 % 26.2–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylosis oblitella

At a glance

Sources6 archives

At a glance

Record type1 330 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 330 records