Ancylopsetta dilecta

(Goode & Bean, 1883) · species

image placeholder — illustration coming later

Animalia/Chordata/Pleuronectiformes/Paralichthyidae/Ancylopsetta

At a glance

Occurrence records796

Data sources9

Biological traits6

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Ancylopsetta dilecta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility422 records↗

OBISOcean Biodiversity Information System374 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS796 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Ancylopsetta dilecta, the three-eye flounder, is a species of large-tooth flounder found along the Atlantic and Caribbean coasts of North and Central America. It is found down to depths of 137 m. This species grows to 25 cm in total length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max366 m

Depth min59 m

Vulnerability15

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylopsetta dilecta has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

112Cvariable

505Gvariable

CCTCTATCTCGTATTTGGTGCCTGAGCCGGAATAGTTGGGACGGCCCTGAGCCTGCTCATTCGGGCAGAGCTCAGCCAACCTGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lepidopsetta bilineatasame order14.6%Paralichthys patagonicussame family14.7%Reinhardtius hippoglossoidessame order14.7%Lepidopsetta polyxystrasame order14.7%Glyptocephalus stellerisame order14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type796 records

Wild obs. + sensor66

Museum / vouchered697

Other33

Origin

Native54

Range

Area of Occupancy AOO1 608 km²

Depth

0–200 m sunlit58

200–1000 m twilight25

1–4 km midnight0

>4 km abyssal1

median 153 m · max 4 976 m · 84 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 63 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 109≤1 km 8≤10 km 16>10 km 29

162 georeferenced · 535 without coordinates

Open the institutions mapphysical evidence697

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Texas Biodiversity Collections (UTBC)location not on record	122
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	68
Texas Cooperative Wildlife Collectionlocation not on record	52
Washington, US	34
FishBaselocation not on record	31
Mexico City, MX	16
Chicago, US	11
San Nicolás de los Garza, MX	10
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	9
CASlocation not on record	3
Montgomery, US	3
North Carolina Museum of Natural Scienceslocation not on record	3
Wuzhou, CN	2
Cambridge, US	2
New Haven, US	1
College Station, US	1
NHMOlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
University of Alabamalocation not on record	1
University of California San Diegolocation not on record	1
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	1
Champaign, US	1
Copenhagen, DK	1

23 institutions · 375 of 697 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Ancylopsetta dilecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.1 °C 23.9–27.1

Seasonal swing summer↔winter10.0 °C

Max temp (day)27.8 °C 24.9–27.9

Min temp (night)26.1 °C 22.9–26.4

Precipitation126 mm/mo 84.9–187

Air humidity61.6 % 61.3–64.3

Vapour deficit1,251 Pa 1,137–1,346

Cloud cover30.0 % 28.5–34.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)