Ancylomenes pedersoni

(Chace, 1958) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Palaemonidae/Ancylomenes

At a glance

Occurrence records1 463

Data sources7

Biological traits4

DNA specimens419

eDNA detections419

Sources7 archives

Databases and archives Ancylomenes pedersoni's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

OBISOcean Biodiversity Information System218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI419 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics419 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 463 records

Environmental DNA1 datasets · 2 countries419 detections

DNA & barcodingBOLD419 specimens

01Narrative

Ancylomenes pedersoni, sometimes known as Pederson's shrimp and Pederson's cleaner shrimp, is a species of cleaner shrimp. It is part of the genus Ancylomenes and was described in 1958 by Fenner A. Chace Jr. as Periclimenes pedersoni. Ancylomenes pedersoni is found in the Caribbean Sea, often associated with a sea anemone, at depths of 1 to. They are often found on the reefs off Bermuda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max35 m

Depth min1 m

05DNA & barcoding419 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylomenes pedersoni has left across the world's sequence archives.

At a glance

DNA specimens419

BINs3

Marker genes3

eDNA detections419

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P584 bp consensus417 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

3Tmostly conserved

39Amostly conserved

42Cmostly conserved

54Cmostly conserved

84Amostly conserved

90Tmostly conserved

120Amostly conserved

123Amostly conserved

126Amostly conserved

132Avariable

138Gmostly conserved

150Cmostly conserved

159Tmostly conserved

162Tmostly conserved

163Tmostly conserved

180Cmostly conserved

183Cmostly conserved

195Amostly conserved

201Amostly conserved

207Cmostly conserved

234Amostly conserved

237Cmostly conserved

258Gmostly conserved

276Tmostly conserved

304Cmostly conserved

306Gmostly conserved

321Gvariable

390Avariable

399Cmostly conserved

411Tvariable

420Tmostly conserved

432Cmostly conserved

456Tmostly conserved

457Tmostly conserved

483Amostly conserved

490Tmostly conserved

501Amostly conserved

525Tmostly conserved

552Tmostly conserved

576Tmostly conserved

ACTTCACTAAGACTTTTAATCCGAGCAGAACTAGGACAACCCGGAAGATTGATCGGAAACGACCAAATTTATAATGTTATTGTAACTGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 29 commonest of 188 variants.

Diversity (π)1.6%

Haplotypes188

BINs3

Most divergent pair9.1%

OtherN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Periclimenes yucatanicussame family16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 463 records

Wild obs. + sensor1 288

Museum / vouchered175

Range

Area of Occupancy AOO1 792 km²

Depth

0–200 m sunlit188

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 55.5 m · 188 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 259≤1 km 189≤10 km 93>10 km 71

612 georeferenced · 676 without coordinates

Open the mapobservation + sensor1 288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	29
FCMMlocation not on record	28
Paris, FR	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	2
Cambridge, US	1

7 institutions · 81 of 175 vouchered records shown · 18 without an institution code

09Environmental DNA419 detections

Where the DNA of Ancylomenes pedersoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found419

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 419 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.4–25.0

Seasonal swing summer↔winter6.50 °C

Max temp (day)25.8 °C 25.8–26.7

Min temp (night)24.0 °C 22.4–24.1

Precipitation91.5 mm/mo 89.5–127

Air humidity60.8 % 60.2–61.1

Vapour deficit1,237 Pa 1,218–1,243

Cloud cover32.9 % 32.6–33.3

CHELSA 1981–2010, ~9 km grid, at location & month of 94 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancylomenes pedersoni

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 463 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 463 records