Ancylolomia japonica

Zeller · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Ancylolomia

At a glance

Occurrence records858

Data sources7

Biological traits0

DNA specimens22

eDNA detections28

Sources7 archives

Databases and archives Ancylolomia japonica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility858 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF858 records

Environmental DNA1 datasets · 4 countries28 detections

DNA & barcodingBOLD22 specimens

01Narrative

Ancylolomia japonica is a moth of the family Crambidae. It is found in Ussuri, Korea, Japan, China (Yunnan, Kansu, Shantung, Fukien, Kwangtung), Tibet and Taiwan. The wingspan is 24–38 mm.Japanese Moths

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylolomia japonica has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections28

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P611 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

9Tmostly conserved

17Tmostly conserved

20Gmostly conserved

53Amostly conserved

59Tmostly conserved

71Cmostly conserved

86Tmostly conserved

113Avariable

152Amostly conserved

170Gmostly conserved

275Amostly conserved

356Amostly conserved

365Gmostly conserved

413Tmostly conserved

497Amostly conserved

503Gvariable

509Avariable

515Tmostly conserved

518Tmostly conserved

530Amostly conserved

536Gmostly conserved

566Tmostly conserved

569Cvariable

581Gmostly conserved

599Tmostly conserved

605Cmostly conserved

CCTTAAGTTTATTAATTCGGGCAGAATTAGGAAATCCTGGTTCATTAATTGGAGATGATCAAATTTATAACACTATTGTTACAGCTCACG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes7

BIN1

Most divergent pair2.9%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylolomia westwoodisame genus7.9%Trachea lacrumasame order9.3%Fissicrambus fissiradiellussame family9.5%Fissicrambus profanellussame family9.5%Lacistodea tauropsissame order9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type858 records

Wild obs. + sensor722

Museum / vouchered136

Range

Area of Occupancy AOO2 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 43≤1 km 29≤10 km 10>10 km 7

89 georeferenced · 633 without coordinates

Open the mapobservation + sensor722

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 28≤1 km 4

32 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hiwa Museum of Natural Historylocation not on record	28
tesrilocation not on record	16
Iwate Prefectural Museumlocation not on record	15
KOMlocation not on record	15
Kawasaki Shi Tama Ku, JP	11
Chiba, JP	9
JP	9
HUNMlocation not on record	8
RCMlocation not on record	7
NSMKlocation not on record	4
Sagamihara, JP	3
Toyota city nature sanctuarylocation not on record	3
Northwest A&F Universitylocation not on record	2
YPIMlocation not on record	2
Ishikawa Museum of Natural Historylocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Shiojiri City Museum of Natural Historylocation not on record	1
National Institute for Agro-Environmental Scienceslocation not on record	1

18 institutions · 136 of 136 vouchered records shown

09Environmental DNA28 detections

Where the DNA of Ancylolomia japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 22.2–28.5

Seasonal swing summer↔winter21.3 °C

Max temp (day)26.5 °C 24.4–31.5

Min temp (night)23.8 °C 18.3–24.6

Precipitation218 mm/mo 141–271

Air humidity69.1 % 61.8–73.5

Moisture balance58.3 mm/mo -30.4–123

Vapour deficit989 Pa 755–1,406

Wind speed4.20 m/s 1.60–4.50

Cloud cover42.0 % 39.1–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)