Ancylis tineana

(Hübner, 1796-1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records897

Data sources9

Biological traits2

DNA specimens40

eDNA detections41

Sources9 archives

Databases and archives Ancylis tineana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility897 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF897 records

Environmental DNA2 datasets · 8 countries41 detections

DNA & barcodingBOLD40 specimens

Genome at a glanceGoaT · NCBI≈453 Mbp

01Narrative

Ancylis tineana is a moth of the family Tortricidae. It is found from southern Sweden to Asia Minor and from the Trans-Caucasus to Siberia and the southern part of eastern Russia. It is also present in North America. The wingspan is 11–15 mm. In Europe, there are two generations per year, with adults on wing from April to May and from July to August. The larvae feed on Malus, Pyrus, Crataegus, Prunus spinosa, Prunus domestica, Betula and Populus tremula. Larvae can occasionally become a pest in orchards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis tineana has left across the world's sequence archives.

At a glance

DNA specimens40

BINs1

Marker genes1

eDNA detections41

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Avariable

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

38Amostly conserved

40Tmostly conserved

41Gmostly conserved

44Amostly conserved

48Cmostly conserved

55Tmostly conserved

56Tmostly conserved

59Cmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

69Cmostly conserved

70Tmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

85Amostly conserved

88Amostly conserved

91Cvariable

124Cvariable

133Amostly conserved

181Amostly conserved

197Tmostly conserved

208Amostly conserved

214Amostly conserved

238Cvariable

277Tmostly conserved

283Gvariable

319Avariable

364Gvariable

394Cvariable

400Tvariable

469Amostly conserved

477Amostly conserved

484Avariable

517Gmostly conserved

529Tmostly conserved

535Tmostly conserved

542Tvariable

548Cvariable

622Gvariable

628Amostly conserved

649Amostly conserved

658Tmostly conserved

AACAATATACTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACATCATTAAGTTTACTAATTCGTGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes9

BIN1

Most divergent pair3.6%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis goodellianasame genus7.9%Ancylis uncellasame genus8.2%Hedya prunianasame family8.7%Syntozyga ephippiassame family9.0%Grapholita internanasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ancylis tineana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈452 848 408 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ancylis tineana0.45 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type897 records

Wild obs. + sensor682

Museum / vouchered203

Other12

Range

Area of Occupancy AOO2 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 184≤1 km 139≤10 km 282>10 km 2

607 georeferenced · 75 without coordinates

Open the mapobservation + sensor682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 39≤1 km 62≤10 km 20>10 km 2

123 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	31
DanishLepidopterologicalSocietylocation not on record	30
University of Alberta Museums (UAM)location not on record	23
NHMOlocation not on record	21
SLU Artdatabankenlocation not on record	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Provincia di Livornolocation not on record	5
New Haven, US	4
Salzburg, AT	3
Stockholm, SE	3
Kuopio, FI	2
St. Paul, US	2
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	2
DABUHlocation not on record	2
East Lansing, US	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
University of Oslo, Natural History Museumlocation not on record	1
Rovaniemi, FI	1
University of Oulu, Zoological Museumlocation not on record	1
Colorado State Universitylocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
South Kensington, GB	1

22 institutions · 166 of 203 vouchered records shown · 37 without an institution code

09Environmental DNA41 detections

Where the DNA of Ancylis tineana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys2

Countries8

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map8 countries0

Wetlandwet meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 1.00–18.6

Seasonal swing summer↔winter24.9 °C

Max temp (day)14.0 °C 5.90–22.2

Min temp (night)6.20 °C -3.80–13.8

Precipitation88.9 mm/mo 60.4–157

Air humidity58.2 % 55.8–63.0

Moisture balance-10.1 mm/mo -57.0–77.1

Vapour deficit557 Pa 244–859

Wind speed2.70 m/s 1.90–7.90

Cloud cover40.1 % 35.9–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)