Ancylis synomotis

(Meyrick, 1911) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records13

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Ancylis synomotis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD6 specimens

01Narrative

Acroclita synomotis is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1911 door Meyrick.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis synomotis has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)2.4%

Haplotypes0

BIN1

Where individuals differ — all 20 variable positions, in barcode order

6Gvariable

10Cvariable

40Gvariable

42Avariable

46Cvariable

85Avariable

88Avariable

94Avariable

118Tvariable

124Tvariable

217Gvariable

220Cvariable

229Avariable

364Tvariable

401Cvariable

413Gvariable

454Cvariable

535Avariable

616Cvariable

625Avariable

AACATGATACTTTATTTTTGGTATTTGAGCTGGAATAGTGGAAACCTCTTTAAGACTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eugnosta deceptanasame family8.7%Lobesia xylistissame family9.0%Olethreutes costimaculanasame family9.4%Olethreutes clavanasame family9.4%Whittenella peltosemasame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor4

Museum / vouchered9

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Insect Collectionlocation not on record	3
Tasmanian Museum & Art Gallerylocation not on record	2

2 institutions · 5 of 9 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Ancylis synomotis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 16.7–25.8

Seasonal swing summer↔winter7.30 °C

Max temp (day)23.4 °C 20.5–31.2

Min temp (night)13.4 °C 12.9–21.4

Precipitation11.3 mm/mo 7.80–58.6

Air humidity59.0 % 54.2–59.8

Moisture balance-98.6 mm/mo -143–-72.0

Vapour deficit825 Pa 773–1,537

Wind speed4.90 m/s 3.20–5.20

Cloud cover34.5 % 27.3–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)