Ancylis subarcuana

(Douglas, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records812

Data sources8

Biological traits2

DNA specimens13

eDNA detections18

Sources8 archives

Databases and archives Ancylis subarcuana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility812 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF812 records

Environmental DNA2 datasets · 5 countries18 detections

DNA & barcodingBOLD13 specimens

01Narrative

Ancylis subarcuana is a species of moth belonging to the family Tortricidae. It is native to Eurasia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis subarcuana has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections18

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

22Tmostly conserved

23Gmostly conserved

31Amostly conserved

38Gmostly conserved

46Tmostly conserved

49Cvariable

55Amostly conserved

59Tmostly conserved

67Tmostly conserved

85Amostly conserved

88Amostly conserved

101Amostly conserved

106Cmostly conserved

157Cmostly conserved

169Amostly conserved

181Amostly conserved

184Tmostly conserved

202Amostly conserved

206Tmostly conserved

208Amostly conserved

211Gmostly conserved

220Tmostly conserved

223Amostly conserved

235Cmostly conserved

259Cmostly conserved

265Amostly conserved

286Amostly conserved

287Tmostly conserved

289Gmostly conserved

291Tmostly conserved

298Tmostly conserved

316Tmostly conserved

319Amostly conserved

322Amostly conserved

328Gmostly conserved

337Gmostly conserved

355Tmostly conserved

364Cmostly conserved

373Tmostly conserved

400Tmostly conserved

401Tmostly conserved

403Amostly conserved

412Tmostly conserved

418Cmostly conserved

436Amostly conserved

469Amostly conserved

484Amostly conserved

490Cmostly conserved

519Cmostly conserved

520Amostly conserved

530Tmostly conserved

532Amostly conserved

533Cmostly conserved

536Tmostly conserved

538Amostly conserved

539Tmostly conserved

541Amostly conserved

542Tmostly conserved

544Amostly conserved

548Tmostly conserved

550Amostly conserved

553Tmostly conserved

556Tmostly conserved

562Amostly conserved

578Cmostly conserved

580Tmostly conserved

581Tmostly conserved

586Amostly conserved

589Cmostly conserved

598Tmostly conserved

613Cmostly conserved

619Amostly conserved

622Amostly conserved

628Amostly conserved

646Cmostly conserved

658Cmostly conserved

AACATTATATTTTATTTTTGGTGTTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGTGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes7

BINs2

Most divergent pair10.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis diminutanasame genus3.8%Ancylis diminuatanasame genus4.3%Ancylis geminanasame genus5.6%Ancylis christiandianasame genus5.9%Cenopis directanasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type812 records

Wild obs. + sensor591

Museum / vouchered221

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 152≤1 km 193≤10 km 167

512 georeferenced · 79 without coordinates

Open the mapobservation + sensor591

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 60≤1 km 87≤10 km 62

209 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence221

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	102
NHMOlocation not on record	29
SLU Artdatabankenlocation not on record	18
DABUHlocation not on record	18
Tartu, EE	10
Rovaniemi, FI	6
RMZlocation not on record	4
Kuopio, FI	1
Helsinki, FI	1
Salzburg, AT	1
Stockholm, SE	1
neflocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

13 institutions · 193 of 221 vouchered records shown · 28 without an institution code

09Environmental DNA18 detections

Where the DNA of Ancylis subarcuana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys2

Countries5

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 8.80–14.1

Seasonal swing summer↔winter21.2 °C

Max temp (day)13.7 °C 10.5–16.2

Min temp (night)7.20 °C 5.20–11.5

Precipitation85.7 mm/mo 51.4–128

Air humidity59.1 % 56.9–59.8

Moisture balance9.70 mm/mo

Vapour deficit557 Pa 470–664

Wind speed2.70 m/s

Cloud cover48.5 % 42.4–59.1

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)