Ancylis sederana — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records7

Data sources6

Biological traits0

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Ancylis sederana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

DNA & barcodingBOLD3 specimens

01Narrative

Ancylis sederana is een vlinder uit de familie bladrollers (Tortricidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1915 door Chrétien. De soort komt voor in tropisch Afrika.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis sederana has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Statherotis euryphaeasame family7.8%Paralobesia palliolanasame family7.9%Paralobesia piceanasame family7.9%Megalota crassanasame family8.5%Cenopis directanasame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor7

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.