Ancylis mediofasciana

(Clemens, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Ancylis

At a glance

Occurrence records274

Data sources7

Biological traits0

DNA specimens23

eDNA detections21

Sources7 archives

Databases and archives Ancylis mediofasciana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF274 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD23 specimens

01Narrative

Ancylis mediofasciana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1864 door Clemens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancylis mediofasciana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

34Gmostly conserved

202Gmostly conserved

466Amostly conserved

520Tmostly conserved

625Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGGATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes4

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancylis goodellianasame genus5.5%Ancylis uncellasame genus5.8%Ancylis pacificanasame genus6.5%Ancylis unguicellasame genus7.0%Endothenia montananasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type274 records

Wild obs. + sensor69

Museum / vouchered205

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 25≤1 km 22≤10 km 3>10 km 6

56 georeferenced · 13 without coordinates

Open the mapobservation + sensor69

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 6≤1 km 25≤10 km 65>10 km 12

108 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	48
San Diego, US	45
New Haven, US	31
Mississippi State, US	22
East Lansing, US	21
Royal Saskatchewan Museumlocation not on record	12
St. Paul, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Colorado State Universitylocation not on record	3
Denver, US	2
Vernal, US	2
San Francisco, US	2
Santa Cruz, US	2
University of California, Davislocation not on record	2
Philadelphia, US	1
Cambridge, US	1
IAWlocation not on record	1
Washington State Department of Agriculturelocation not on record	1

18 institutions · 203 of 205 vouchered records shown · 2 without an institution code

09Environmental DNA21 detections

Where the DNA of Ancylis mediofasciana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 13.1–15.5

Seasonal swing summer↔winter30.0 °C

Max temp (day)18.1 °C 18.1–22.0

Min temp (night)7.70 °C 7.70–9.80

Precipitation105 mm/mo 70.2–105

Air humidity56.1 % 53.9–56.1

Moisture balance-8.70 mm/mo -70.6–-8.70

Vapour deficit661 Pa 661–827

Wind speed2.80 m/s 2.80–4.30

Cloud cover52.8 % 41.1–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)