Ancognatha vulgaris

Arrow, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Ancognatha

At a glance

Occurrence records2 189

Data sources4

Biological traits0

DNA specimens42

eDNA detections40

Sources4 archives

Databases and archives Ancognatha vulgaris's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 189 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD42 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancognatha vulgaris has left across the world's sequence archives.

At a glance

DNA specimens42

BINs2

Marker genes1

eDNA detections40

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus40 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

112Tmostly conserved

235Tmostly conserved

466Cmostly conserved

574Gmostly conserved

619Cmostly conserved

CTTATATTTTCTTTTCGGAAGTTGATCAGGAATAGTAGGAACTTCCCTAAGACTTTTAATTCGTGCAGAGCTTGGGAACCCTGGGTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes6

BINs2

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancognatha vexanssame genus11.1%Ancognatha gracilissame genus11.8%Ancognatha mancasame genus11.8%Aspidolea singularissame family16.4%Trypoxylus dichotomussame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 189 records

Wild obs. + sensor941

Museum / vouchered1 248

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 351≤1 km 412≤10 km 41>10 km 14

818 georeferenced · 123 without coordinates

Open the mapobservation + sensor941

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 1≤1 km 7≤10 km 50>10 km 3

61 georeferenced · 1 187 without coordinates

Open the institutions mapphysical evidence1 248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	1 006
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	87
Paris, FR	37
ASUlocation not on record	33
Universidad del Quindío (UniQuindío)location not on record	22
Universidad Nacional de Colombia (UNAL)location not on record	22
Corporación Colombiana de Investigación Agropecuaria - AGROSAVIAlocation not on record	10
Wuzhou, CN	8
Caja de Compensación Familiar - Comfenalco Antioquialocation not on record	5
Universidad del Magdalena (UniMagdalena)location not on record	5
Museo del Laboratorio de Entomología Agrícola Fitosanitariolocation not on record	4
Toronto, CA	4
Universidad del Atlántico (UniAtlantico)location not on record	1
Universidad del Tolima (UT)location not on record	1
Smithsonian Tropical Research Institutelocation not on record	1
BioAlfalocation not on record	1

16 institutions · 1 247 of 1 248 vouchered records shown · 1 without an institution code

09Environmental DNA40 detections

Where the DNA of Ancognatha vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 19.0–23.8

Seasonal swing summer↔winter2.40 °C

Max temp (day)24.5 °C 21.8–26.7

Min temp (night)17.1 °C 15.3–21.2

Precipitation378 mm/mo 88.5–517

Air humidity70.8 % 64.0–75.1

Moisture balance231 mm/mo -39.8–406

Vapour deficit794 Pa 518–992

Wind speed2.00 m/s 1.10–3.80

Cloud cover33.7 % 15.7–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ancognatha vulgaris

At a glance

Sources4 archives

At a glance

Record type2 189 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 189 records