Ancistroteuthis lichtensteinii

Ferussac, 1835,1834 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Oegopsida/Onychoteuthidae/Ancistroteuthis

At a glance

Occurrence records429

Data sources6

Biological traits7

DNA specimens78

eDNA detections80

Sources6 archives

Databases and archives Ancistroteuthis lichtensteinii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility180 records↗

OBISOcean Biodiversity Information System249 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS429 records

Environmental DNA2 datasets · 3 countries80 detections

DNA & barcodingBOLD78 specimens

01Narrative

Ancistroteuthis lichtensteinii, also known as the angel clubhook squid or simply angel squid, is a species of squid in the family Onychoteuthidae and the sole member of the genus Ancistroteuthis. It grows to a mantle length of 30 cm.Roper C.F.E., M.J. Sweeney & C.E. Nauen (1984). Cephalopods of the world. Food and Agriculture Organization, Rome, Italy. It lives in the western Mediterranean Sea, subtropical and tropical eastern Atlantic Ocean and western north Atlantic Ocean. Its diet include mesopelagic fish and pelagic crustaceans. It is sometimes taken as bycatch by commercial fisheries, but is not a targeted species. Dorsal and ventral views of juvenile ''A. lichtensteinii'' (16 mm ML) Dorsal and lateral views of head and occipital folds (145 mm ML) Oral view of tentacular club (145 mm ML) Ventral and enlarged side views of [[Gladius (cephalopod)|gladius]] (165 mm ML) Upper (left) and lower (right) beaks (URL ca. 3 mm)

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof potential interest

Other traits3

Depth max1 102 m

Depth min0 m

Vulnerability20

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistroteuthis lichtensteinii has left across the world's sequence archives.

At a glance

DNA specimens78

BINs1

Marker genes1

eDNA detections80

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus77 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

573Cvariable

TGAGCAGGATTATTAGGAACTTCCCTAAGTCTAATAATCCGTACTGAATTAGGACAACCAGGATCACTCCTAAACGATGATCAACTATAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes3

BIN1

Most divergent pair0.31%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Filippovia knipovitchisame family10.4%Moroteuthopsis longimanasame family11.2%Notonykia africanaesame family11.2%Moroteuthopsis ingenssame family12.2%Bathyteuthis abyssicolasame order13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type429 records

Wild obs. + sensor1

Museum / vouchered172

Other256

Range

Area of Occupancy AOO1 124 km²

Depth

0–200 m sunlit20

200–1000 m twilight207

1–4 km midnight11

>4 km abyssal0

median 545.6 m · max 2 165 m · 238 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence172

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	63
ICATMARlocation not on record	28
IEOlocation not on record	12
The Atlantic reference Centrelocation not on record	9
IEO-COMA-CSIClocation not on record	5
ICM-CSIClocation not on record	3
Museums Victorialocation not on record	3
Paris, FR	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

9 institutions · 125 of 172 vouchered records shown · 19 without an institution code

09Environmental DNA80 detections

Where the DNA of Ancistroteuthis lichtensteinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map3 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.8–21.5

Seasonal swing summer↔winter4.80 °C

Max temp (day)21.7 °C 21.4–21.9

Min temp (night)20.8 °C 20.2–21.1

Precipitation0.8 mm/mo 0.7–4.20

Air humidity77.7 % 72.7–79.2

Vapour deficit563 Pa 520–688

Cloud cover15.4 % 14.7–18.2

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)