Ancistrocladus tectorius

(Lour.) Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Ancistrocladaceae/Ancistrocladus

At a glance

Occurrence records170

Data sources10

Biological traits27

DNA specimens61

eDNA detections54

Sources10 archives

Databases and archives Ancistrocladus tectorius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics61 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF170 records

Environmental DNA1 datasets · 1 countries54 detections

DNA & barcodingBOLD · NCBI61 specimens

01Narrative

Ancistrocladus tectorius is a species in the monogeneric family Ancistrocladaceae found in China (Hainan), Cambodia, India (Andaman and Nicobar Islands), Indonesia, Laos, Malaysia, Myanmar, Singapore, Thailand, and Vietnam.Kew World Checklist of Selected Plant Families The Vietnamese name is trung quân lợp nhà; , gou zhi teng.Taylor, C.M., Gereau, R.E. & Walters, G.M. (2005). Revision of Ancistrocladus Wall. (Ancistrocladaceae). Annals of the Missouri Botanical Garden 92: 360-399.Pandey, R.P. & Dilwakar, P.G. (2008). An integrated check-list flora of Andaman and Nicobar islands, India. Journal of Economic and Taxonomic Botany 32: 403-500. Climbing A. tectorius showing tendrils

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length85 mm

Leaf length max100 mm

Leaf length min70 mm

Leaf width50 mm

Leaf width max70 mm

Leaf width min30 mm

Plant height13.5 m

⚠ sources differ — GIFT: 13.5 m · TRY: 10 m

Plant height max10 m

Plant height min4 m

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typewind

Flower length max8 mm

Flower length min7 mm

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberobligatory

Elevation max700 m

Elevation mean600 m

Elevation min500 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: climber

Woodinesswoody

Physiology & chemistry3

Leaf dry-matter content (LDMC)357 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)14.54 mm²/mg

03Chemical composition32 compounds

Compounds documented for Ancistrocladus tectorius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids24

Naphthoquinones3

Bisnaphthalenes2

Lupane triterpenoids2

Naphthalenes and derivatives $ Naphthoquinones1

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Ancistrocladine	present	LOTUS
(1S)-1,2,3,4-Tetrahydro-8-methoxy-1alpha,3beta-dimethyl-5-[(aR)-4,5-dimethoxy-2-methyl-1-naphthalenyl]isoquinoline-6-ol	present	LOTUS
(1S,3S)-5-(4-hydroxy-5-methoxy-2-methylnaphthalen-1-yl)-8-methoxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-6-ol	present	LOTUS
(3S)-5-(4,5-dimethoxy-2-methylnaphthalen-1-yl)-8-methoxy-1,3-dimethyl-3,4-dihydroisoquinolin-6-ol	present	LOTUS
2-(6,8-dimethoxy-1,2,3-trimethyl-3,4-dihydro-1H-isoquinolin-7-yl)-8-methoxy-3-methylnaphthalen-1-ol	present	LOTUS
2-[(1R,3R)-6,8-dimethoxy-1,2,3-trimethyl-3,4-dihydro-1H-isoquinolin-7-yl]-8-methoxy-3-methylnaphthalen-1-ol	present	LOTUS
4-[(1R,3S)-6,8-dimethoxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-7-yl]-8-methoxy-3-methylnaphthalen-1-ol	present	LOTUS
5'-O-Demethylancistrocline	present	LOTUS
5-(4,5-Dimethoxy-2-methylnaphthalen-1-yl)-6,8-dimethoxy-1,3-dimethylisoquinoline	present	LOTUS
5-(4,5-Dimethoxy-2-methylnaphthalen-1-yl)-8-methoxy-1,2,3-trimethyl-3,4-dihydroisoquinolin-6-one	present	LOTUS

05DNA & barcoding61 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocladus tectorius has left across the world's sequence archives.

At a glance

DNA specimens61

Marker genes7

GenBank sequences10

eDNA detections54

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ365444.1 ↗425 bpThailand · 2021

ACGT

CGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATAGCATCGCCCCTACACCCTACGCGTAGCATGGGGTGATCGGGGCGG …

Ancistrocladus tectorius voucher ACN-55 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL4★rbcLa★trnL-F★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type170 records

Wild obs. + sensor9

Museum / vouchered161

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced · 4 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 4>10 km 2

7 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	29
Beijing, CN	19
Guilin, CN	14
Edinburgh, GB	7
Guangzhou, CN	6
Moscow State Universitylocation not on record	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	4
Kew, GB	4
Bronx, US	3
Claremont, US	3
Changsha, CN	2
Chengdu, CN	2
Kunming, CN	2
National Institute of Biological Resourceslocation not on record	2
University of Stellenboschlocation not on record	1
Saint Louis, US	1
South Kensington, GB	1
Taipei, TW	1
South China Normal Universitylocation not on record	1
Chengdu, CN	1
Wuhan, CN	1
Paris, FR	1
Kagoshima, JP	1
Columbia, US	1

24 institutions · 112 of 161 vouchered records shown · 49 without an institution code

09Environmental DNA54 detections

Where the DNA of Ancistrocladus tectorius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 25.8–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 29.1–29.5

Min temp (night)22.6 °C 22.6–23.2

Precipitation269 mm/mo 269–402

Air humidity68.1 % 68.1–71.0

Moisture balance133 mm/mo 133–272

Vapour deficit1,080 Pa 963–1,080

Wind speed1.20 m/s 1.00–1.20

Cloud cover57.6 % 57.6–65.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)