Ancistrocladus korupensis

D.W.Thomas & Gereau · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Ancistrocladaceae/Ancistrocladus

At a glance

Occurrence records47

Data sources10

Biological traits8

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Ancistrocladus korupensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Ancistrocladus korupensis is a species of liana endemic to southwestern Cameroon and the neighbouring regions of Nigeria. The type locality is Korup National Park. The plant was identified as new to science in 1993 after pharmacologically intriguing alkaloids were found in its leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber or creeper

Woodinessvariable

03Chemical composition50 compounds

Compounds documented for Ancistrocladus korupensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Naphthoquinones24

Isoquinoline alkaloids15

Flavan-3-ols2

Furofuranoid lignans2

Simple coumarins2

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(-)-Ancistrocladine	present	LOTUS
(-)-Catechol	present	NPASS
(-)-Episyringaresinol	present	NPASS
(-)-Michellamine A	present	LOTUS
(-)-Michellamine B	present	NPASS
(1R,3R)-5-[3-[4-[(1S,3S)-6,8-dihydroxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-5-yl]-1-hydroxy-8-methoxy-6-methylnaphthalen-2-yl]-4-hydroxy-5-methoxy-7-methylnaphthalen-1-yl]-1,2,3-trimethyl-3,4-dihydro-1H-isoquinoline-6,8-diol	present	LOTUS
(1R,3R)-5-[3-[4-[(1S,3S)-6,8-dihydroxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-5-yl]-1-hydroxy-8-methoxy-6-methylnaphthalen-2-yl]-4-hydroxy-5-methoxy-7-methylnaphthalen-1-yl]-1,3-dimethyl-1,2,3,4-tetrahydroisoquinoline-6,8-diol	present	LOTUS
(1R,3R)-5-[4-hydroxy-3-[1-hydroxy-4-[(3R)-6-hydroxy-8-methoxy-1,3-dimethyl-3,4-dihydroisoquinolin-7-yl]-8-methoxy-6-methyl-2-naphthyl]-5-methoxy-7-methyl-1-naphthyl]-1,3-dimethyl-1,2,3,4-tetrahydroisoquinoline-6,8-diol	present	LOTUS
(1R,3R)-7-(4,5-dimethoxy-2-methylnaphthalen-1-yl)-1,2,3-trimethyl-3,4-dihydro-1H-isoquinolin-8-ol	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocladus korupensis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences7

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSHM204875.1 ↗738 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAATGACCCGCGAACATGTTACTTAAA …

Ancistrocladus korupensis isolate TR116 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type47 records

Museum / vouchered47

Range

Area of Occupancy AOO64 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 47 records without

Open the institutions mapphysical evidence47

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	17
Yaoundé, CM	8
Kew, GB	4
Paris, FR	1
Leiden University Medical Centerlocation not on record	1
MAlocation not on record	1
Uppsala, SE	1

7 institutions · 33 of 47 vouchered records shown · 14 without an institution code

09Environmental DNA6 detections

Where the DNA of Ancistrocladus korupensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)