Ancistrocladus heyneanus

Wall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Ancistrocladaceae/Ancistrocladus

At a glance

Occurrence records119

Data sources7

Biological traits9

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Ancistrocladus heyneanus's data was compiled from.

GBIFGlobal Biodiversity Information Facility119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF119 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Dispersal typewind

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

03Chemical composition23 compounds

Compounds documented for Ancistrocladus heyneanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoquinoline alkaloids17

Naphthoquinones6

Naphthalenes and derivatives $ Naphthoquinones1

Lupane triterpenoids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Ancistrocladine	present	LOTUS
(-)-Michellamine A	present	LOTUS
(1R,3R)-5-[3-[4-[(1S,3S)-6,8-dihydroxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-5-yl]-1-hydroxy-8-methoxy-6-methylnaphthalen-2-yl]-4-hydroxy-5-methoxy-7-methylnaphthalen-1-yl]-1,3-dimethyl-1,2,3,4-tetrahydroisoquinoline-6,8-diol	present	LOTUS
(1R,3S)-5-(4,5-dimethoxy-2-methylnaphthalen-1-yl)-8-methoxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinolin-6-ol	present	LOTUS
(1S)-1,2,3,4-Tetrahydro-8-methoxy-1alpha,3beta-dimethyl-5-[(aR)-4,5-dimethoxy-2-methyl-1-naphthalenyl]isoquinoline-6-ol	present	NPASS
(3R)-7-(1-hydroxy-8-methoxy-3-methylnaphthalen-2-yl)-8-methoxy-1,3-dimethyl-3,4-dihydroisoquinolin-6-ol	present	LOTUS
(3S)-5-(4,5-dimethoxy-2-methylnaphthalen-1-yl)-8-methoxy-1,3-dimethyl-3,4-dihydroisoquinolin-6-ol	present	LOTUS
(3S)-7-(5-hydroxy-4-methoxy-7-methylnaphthalen-1-yl)-8-methoxy-1,3-dimethyl-3,4-dihydroisoquinolin-6-ol	present	LOTUS
4,8-dihydroxy-3-methyl-3,4-dihydro-2H-naphthalen-1-one	present	LOTUS
5-(4,5-Dimethoxy-2-methylnaphthalen-1-yl)-6,8-dimethoxy-1,3-dimethyl-1,2,3,4-tetrahydroisoquinoline	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocladus heyneanus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences5

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSHM204874.1 ↗740 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACCCGCGAACATGTTACATAAA …

Ancistrocladus heyneanus isolate TR115 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type119 records

Wild obs. + sensor119

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 10≤1 km 88≤10 km 15>10 km 1

114 georeferenced · 5 without coordinates

Open the mapobservation + sensor119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA3 detections

Where the DNA of Ancistrocladus heyneanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)