Ancistrocarya japonica

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Ancistrocarya

At a glance

Occurrence records125

Data sources6

Biological traits4

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Ancistrocarya japonica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ancistrocarya (лат.) — монотипный род двудольных растений семейства Бурачниковые (Boraginaceae), включающий вид Ancistrocarya japonica Maxim.. Выделен российским ботаником Карлом Ивановичем Максимовичем в 1872 году.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocarya japonica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK321727.1 ↗611 bpJapan

ACGT

TGCATAGCAGAACCACTAGCGAACAAGTTTATGAACACGGGCTCCGGTTAATACGGGATACTCCTTGCTATTGATCGGAGCCTATTGGTA …

Ancistrocarya japonica isolate W2988 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor2

Museum / vouchered123

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 37

37 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	65
Odawara, JP	13
Kochi, JP	13
FFPRIlocation not on record	11
Sendai, JP	7
Nagano City, JP	7
Sanda, JP	5
Chiba, JP	1
Nishihara, JP	1

9 institutions · 123 of 123 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ancistrocarya japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)