Ancistrocarphus filagineus

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ancistrocarphus

At a glance

Occurrence records1 005

Data sources8

Biological traits14

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Ancistrocarphus filagineus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 005 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Occurrence & distributionGBIF1 005 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Ancistrocarphus filagineus is a North American species of flowering plants in the family Asteraceae, known by the common names woolly fishhooks and hooked groundstar. It is native to western North America, including Idaho, Oregon, Nevada, California, and Baja California.Biota of North America Program 2014 county distribution mapCalflora taxon report, University of California, Ancistrocarphus filagineus A. Gray, false neststraw, woolly fishhooks Ancistrocarphus filagineus grows in many types of habitat, including bare, rocky habitat with clay or serpentine soils and recently burned areas. It is a petite annual herb rarely more than 15 cm (6 inches) tall. It has gray, woolly-haired herbage. The linear, lance-shaped, or oval leaves are up to 3 centimeters long and are alternately arranged on the short stems. The inflorescence is a cluster of a few small star-shaped flower heads a few millimeters wide.Flora of North America, Ancistrocarphus filagineusJepson Manual Treatment

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.049 mg

Seed mass max0.049 mg

Seed mass min0.049 mg

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf C:N ratio41.47 g/g

Leaf dry-matter content (LDMC)212 mg/g

Specific leaf area (SLA)17.29 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancistrocarphus filagineus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF963790.1 ↗721 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACAA …

Ancistrocarphus filagineus isolate CBP004 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1rbcLaITS1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 005 records

Wild obs. + sensor418

Museum / vouchered587

Origin

Native2

Range

Area of Occupancy AOO2 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 247≤1 km 14≤10 km 5>10 km 25

291 georeferenced · 127 without coordinates

Open the mapobservation + sensor418

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 37≤1 km 162≤10 km 103>10 km 7

309 georeferenced · 278 without coordinates

Open the institutions mapphysical evidence587

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	83
Santa Barbara, US	63
Riverside, US	62
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	38
Davis, US	32
San Luis Obispo, US	25
Corvallis, US	23
CASlocation not on record	22
Arcata, US	22
Bronx, US	22
San Diego, US	22
Caldwell, US	16
Moscow, US	10
Henderson, US	9
Canadian Department of Agriculturelocation not on record	8
Pullman, US	7
US	7
WTUlocation not on record	7
Logan, US	3
Flagstaff, US	3
Los Angeles, US	2
VALElocation not on record	2
Provo, US	2
Northridge, US	2
Wuzhou, CN	2
Boise, US	2
Mexico City, MX	1
Irvine, US	1
Vancouver, CA	1
Santa Cruz, US	1
Bloomington, US	1
Madison, US	1
San Jose, US	1
EL PASO, US	1
Nantes Culture Collectionlocation not on record	1
Dover, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1

37 institutions · 507 of 587 vouchered records shown · 80 without an institution code

09Environmental DNA2 detections

Where the DNA of Ancistrocarphus filagineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Southern mixed chaparral with patches of coa…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 19.9–19.9

Seasonal swing summer↔winter14.8 °C

Max temp (day)28.2 °C

Min temp (night)13.0 °C

Precipitation2.90 mm/mo

Air humidity49.2 %

Moisture balance-181 mm/mo

Vapour deficit1,190 Pa

Wind speed2.90 m/s

Cloud cover16.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

Ancistrocarphus filagineus

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Physiology & chemistry3

At a glance

Record type1 005 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 005 records