Anchusa strigosa

Banks & Sol. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Anchusa

At a glance

Occurrence records2 134

Data sources10

Biological traits9

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Anchusa strigosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS44 compounds

Occurrence & distributionGBIF2 134 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 32

01Narrative

لسان الثور البومي نوع نباتي يتبع جنس لسان الثور من الفصيلة الحِمحِمية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass23.04 mg

Life cycle & reproduction3

Life formbiennial or perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

03Chemical composition44 compounds

Compounds documented for Anchusa strigosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids8

Pyrrolizidine alkaloids7

Menthane monoterpenoids5

Ursane and Taraxastane triterpenoids5

Cinnamic acids and derivatives4

Documented compounds44 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(2,4-Dihydroxy-6-methyl-3-propan-2-ylphenyl) acetate	present	NPASS
(2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[4-(3-methylbut-2-enyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenoxy]oxane-3,4,5-triol	present	LOTUS
(2R,4aR,6aR,6aS,6bR,8aR,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-2,6a,6b,9,12a-pentamethyl-2-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(2S)-2-hydroxy-2-[(1S)-1-hydroxyethyl]-4-methylpentanoic acid	present	LOTUS
(2S,3R,4S,5S,6R)-2-[4-[(2S,3R,4R,5S)-5-(4-hydroxy-3,5-dimethoxyphenyl)-3,4-bis(hydroxymethyl)oxolan-2-yl]-2,6-dimethoxyphenoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3,4-Dihydroxy-5-methyl-2-propan-2-ylphenyl) acetate	present	NPASS
(3-Acetyloxy-4-hydroxy-5-methyl-2-propan-2-ylphenyl) acetate	present	NPASS
(4aR,5S,9S,9aS)-9-(hydroxymethyl)-2,5,9-trimethyl-4,4a,6,7,8,9a-hexahydro-3H-benzo[7]annulen-5-ol	present	NPASS
(5-Methyl-3,6-dioxo-2-propan-2-ylcyclohexa-1,4-dien-1-yl) acetate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchusa strigosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY383292.1 ↗272 bp

ACGT

GAATCCTGCATAGCCGAACCACTCGTGAATAAGTTAGTAACAAATATGGCATTATGGTCTGTGGGTATACCTTACATTCTAGTGTGCCTC …

Anchusa strigosa internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anchusa strigosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 134 records

Wild obs. + sensor2 082

Museum / vouchered52

Range

Area of Occupancy AOO3 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 274≤1 km 64≤10 km 248>10 km 8

594 georeferenced · 1 488 without coordinates

Open the mapobservation + sensor2 082

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 1≤10 km 11

12 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	12
Berlin, DE	10
Paris, FR	7
Rishon Le Zion, IL	7
LDlocation not on record	6
Wlocation not on record	3
Frankfurt am Main	2

7 institutions · 47 of 52 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Anchusa strigosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anchusa strigosa

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Diet & foraging1

Habitat & environment4

Compound class profile5 classes

Documented compounds44 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 134 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 134 records