Anchusa officinalis
speciesAt a glance
Occurrence records74 329
Data sources13
Biological traits44
DNA specimens18
eDNA detections3
Sources13 archives
Databases and archives Anchusa officinalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility74 329 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics18 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources44 traits
Chemical compositionLOTUS · NPASS72 compounds
Occurrence & distributionGBIF74 329 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI18 specimens
Genome at a glanceCCDB · GoaT7.1 Gbp
01Narrative
La Buglosse officinale est une espèce de plantes herbacées de la famille des Boraginaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Leaf mass63.02 mg
Leaf size1 377 mm²
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · LEDA: 0.475 m · TRY: 0.249 m
Plant height generative0.55 m
Plant height max1 m
Plant height min0.3 m
Seed length3.5 mm
Seed mass4.14 mg
⚠ sources differ — TRY: 4.14 mg · LEDA: 5 mg · GIFT: 5.05 mg
Seed mass max3.91 mg
Seed mass min3.91 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: zoochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanbiennial/perennial
⚠ sources differ — TRY: biennial/perennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number618
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcropfields,forest,parks
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)114 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)9.48 mm²/mg
⚠ sources differ — TRY: 9.48 mm²/mg · LEDA: 23.27 mm²/mg · GIFT: 23.27 mm²/mg
Other traits2
Diaspore typemericarp
Monocarpymonocarp
03Chemical composition72 compounds
Compounds documented for Anchusa officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives8
Oleanane triterpenoids7
Prezizaane sesquiterpenoids5
Simple phenolic acids4
Pyrrolizidine alkaloids3
Documented compounds72 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-3-Carene | present | NPASS | |
| (+/-)-trans-3,4-Divanillyltetrahydrofuran | present | NPASS | |
| (-)-Illicinone A | present | NPASS | |
| (1S,2R)-1-(4-methoxyphenyl)propane-1,2-diol | present | NPASS | |
| (1S,2R,5R,6R,7S,8R,11R)-5,7,11-trihydroxy-7-(methoxymethyl)-2-methylspiro[9-oxatricyclo[6.3.1.01,5]dodecane-6,3'-oxetane]-2',10-dione | present | NPASS | |
| (1S,2S)-1-(4-methoxyphenyl)propane-1,2-diol | present | NPASS | |
| (3S,3aR,4aS,6aR,7R,9aS,9bS)-Decahydro-7-[(1R,4Z)-6-methoxy-1,5-dimethyl-6-oxo-4-hexen-1-yl]-6a,9a-dimethyl-3-(1-methylethenyl)-1H-cyclopenta[a]cyclopropa[e]naphthalene-3a(4H)-propanoic acid | present | NPASS | |
| (3S,4aR,6aR,6aS,6bR,8aR,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (3S,4aR,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-10-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (3S,4aR,6aR,6aS,6bR,8aS,9R,10S,12aR,14bR)-10-hydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS |
05DNA & barcoding18 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchusa officinalis has left across the world's sequence archives.
At a glance
DNA specimens18
Marker genes3
GenBank sequences10
eDNA detections3
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTTGAAGCCATTAGGCTAAAGGCACGTCTGCCTGGGCGTCACGCATC …
Anchusa officinalis voucher HAVR-2017-38 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★ITS5
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Anchusa officinalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size7 144 290 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Anchusa officinalis7.14 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–322n range16median16mode32records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1629×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — D'AMATO G., TROJANI ZH. - 1985. Giemsa banding and karyotype in three species of Anchusa (Boraginaceae).. Caryologia , 38(1): 13-21.
CCDB · ita-fl — Bigazzi M., Nardi E., Selvi F. - 1997. Anchusella, a new genus of Boraginaceae from the Central-Eastern Mediterranean. Pl. Syst. Evol. , 205: 241-264.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3427
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · mediterranean
CCDB · ipcn-api-dl — D'Amato, G. & Z. Trojani. 1985. Giemsa banding and karyotype in three species of Anchusa (Boraginaceae). Caryologia 38: 13–21.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. 1980. In Chromosome number reports LXIX. Taxon 29: 709–710.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Markova, M. & V. Goranova. 1995. Mediterranean chromosome number reports 5 (435--473). Fl. Medit. 5: 289–317.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — FOERNKRANZ, D. 1967. Einige neue Boraginaceen-Chromosomenzahlen. Oesterr. Bot. Zeits. 114: 341-345.
CCDB · book-fedorov — Smith S. G. 1931, 1932
CCDB · book-fedorov — Strey 1931
CCDB · book-fedorov — Tischler 1934 .
CCDB · book-fedorov — JleBHTCKHH (T. 19351936) .
CCDB · book-fedorov — S)lgiura 1938, 1940b
CCDB · book-fedorov — Love A., LOve D. 19'h
CCDB · book-fedorov — Britton 1951
CCDB · book-atlas-flowering-plants
2n 322×CCDB · mediterranean · CCDB · ipcn-api-dl
CCDB · mediterranean
CCDB · ipcn-api-dl — Markova, M. & V. Goranova. 1995. Mediterranean chromosome number reports 5 (435--473). Fl. Medit. 5: 289–317.
2n 181×CCDB · Automatic manuscript search
CCDB · Automatic manuscript search — F. Selvi and M. Bigazzi. 2000. "Removal of Anchusa macedonica from Anchusa (Boraginaceae): evidence from phenetics and karyotypic analysis". Taxon 49:765-778.
n 82×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — DELAY, J. 1969. Boraginacees I. Inf. Ann. Caryosyst. et Cytogenet. 3: 7-8.
CCDB · book-ipcn67-71 — FOERNKRANZ, D. 1967. Einige neue Boraginaceen-Chromosomenzahlen. Oesterr. Bot. Zeits. 114: 341-345.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type74 329 records
Wild obs. + sensor69 116
Museum / vouchered5 050
Cultivated / captive33
Other130
Origin
Native11
Introduced341
Range
Area of Occupancy AOO97 452 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy66% within 1 km
≤100 m 31 309≤1 km 7 810≤10 km 19 812>10 km 272
59 203 georeferenced · 9 913 without coordinates
Open the mapobservation + sensor69 116
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 264≤1 km 906≤10 km 1 337>10 km 116
2 623 georeferenced · 2 427 without coordinates
Open the institutions mapphysical evidence5 050
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤100 m 1≤1 km 2≤10 km 4>10 km 15
22 georeferenced · 11 without coordinates
Open the mapnot free-living33
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions90 of 167 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 539 |
| LDlocation not on record | 403 |
| Berlin, DE | 384 |
| Olocation not on record | 234 |
| BRNUlocation not on record | 166 |
| BFLlocation not on record | 135 |
| SLU Artdatabankenlocation not on record | 130 |
| Oskarshamn, SE | 130 |
| MeiseBGlocation not on record | 124 |
| Uniwersytet Warszawskilocation not on record | 110 |
| Adam Mickiewicz University in Poznańlocation not on record | 95 |
| Turku, FI | 91 |
| IFR-DNFlocation not on record | 88 |
| Tartu, EE | 73 |
| Moscow State Universitylocation not on record | 72 |
| Salzburg, AT | 71 |
| Uppsala, SE | 69 |
| Kuopio, FI | 64 |
| Trondheim, NO | 62 |
| BIO-UNIPIlocation not on record | 59 |
| Oulu, FI | 52 |
| TUR-Alocation not on record | 50 |
| Görlitz, DE | 41 |
| Tallinn, EE | 39 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Philadelphia, US | 36 |
| Museo Entomologico de Leonlocation not on record | 29 |
| KMNlocation not on record | 29 |
| Bergen, NO | 27 |
| Bern, CH | 27 |
| Provincia di Livornolocation not on record | 23 |
| GJOlocation not on record | 22 |
| Wlocation not on record | 22 |
| Pullman, US | 22 |
| Frankfurt am Main | 20 |
| Mlocation not on record | 19 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 18 |
| Karlsruhe, DE | 17 |
| Bronx, US | 17 |
| Uniwersytet Śląski w Katowicachlocation not on record | 17 |
| Brussel, BE | 17 |
| Provo, US | 16 |
| WTUlocation not on record | 16 |
| DBF-NHMDlocation not on record | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| Jyväskylä, FI | 13 |
| South Kensington, GB | 13 |
| Voronezh State Universitylocation not on record | 12 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 12 |
| Stockholm, SE | 11 |
| Zürich, CH | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| SZUlocation not on record | 10 |
| Vancouver, CA | 10 |
| Corvallis, US | 8 |
| Porrentruy, CH | 8 |
| Zürich, CH | 8 |
| Tilburg, NL | 8 |
| Porvoo, FI | 8 |
| Helsinki, FI | 7 |
| Dresden, DE | 7 |
| Barcelona, ES | 6 |
| Cheney, US | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Moscow, US | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 5 |
| Bozeman, US | 5 |
| LfUlocation not on record | 5 |
| Saint Louis, US | 5 |
| Boise, US | 5 |
| Victoria, CA | 5 |
| TROMlocation not on record | 5 |
| Ann Arbor, US | 5 |
| Paris, FR | 5 |
| Weber State Universitylocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| H-Wolflocation not on record | 4 |
| PRClocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Universität Göttingenlocation not on record | 4 |
| BGBMlocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Nijmegen, NL | 4 |
| Wuzhou, CN | 4 |
| BClocation not on record | 4 |
| Göteborg, SE | 4 |
| Claremont, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| MAlocation not on record | 3 |
| Durango, US | 3 |
| UoB-IBlocation not on record | 3 |
| No collectionlocation not on record | 3 |
| UGentlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Denver, US | 3 |
| ASUlocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| Tampa, US | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Madison, US | 2 |
| Bloomington, US | 2 |
| Tacoma, US | 2 |
| Davis, US | 2 |
| Logan, US | 2 |
| Auckland, NZ | 2 |
| Philadelphia, US | 2 |
| NBSIlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Forssa, FI | 2 |
| Pamplona, ES | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| València, ES | 2 |
| Xiamen, CN | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| BDBClocation not on record | 2 |
| Podgorica, ME | 2 |
| Hobart, AU | 2 |
| Canadian Department of Agriculturelocation not on record | 1 |
| nbflocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Wellington, NZ | 1 |
| H-Schuhwlocation not on record | 1 |
| San Isidro, AR | 1 |
| STNFlocation not on record | 1 |
| Salamanca, ES | 1 |
| National Museums Northern Ireland (Ulster Museum)location not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Lausanne, CH | 1 |
| Frauenfeld, CH | 1 |
| Portland, US | 1 |
| Burlington, US | 1 |
| Millersville, US | 1 |
| Lincoln, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Whitehorse, CA | 1 |
| Dekalb, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Missoula, US | 1 |
| GZUlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Miami, US | 1 |
| Bangkok, TH | 1 |
| Durham, US | 1 |
| Macomb, US | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Baroda, IN | 1 |
| Nanjing, CN | 1 |
| Grand Junction, US | 1 |
| Chadron, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Umeå Universitylocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Chicago, US | 1 |
| Fulda, DE | 1 |
| Flagstaff, US | 1 |
| QVMAGlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Riverside, US | 1 |
| US | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| BSBIlocation not on record | 1 |
167 institutions · 4 152 of 5 050 vouchered records shown · 601 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA3 detections
Where the DNA of Anchusa officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.4 °C 17.4–17.4
Seasonal swing summer↔winter13.6 °C
Max temp (day)19.9 °C
Min temp (night)14.6 °C
Precipitation82.2 mm/mo
Air humidity62.8 %
Moisture balance-39.5 mm/mo
Vapour deficit737 Pa
Wind speed2.70 m/s
Cloud cover39.1 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.